ID: 1155370828

View in Genome Browser
Species Human (GRCh38)
Location 18:25098463-25098485
Sequence CTGCAAACACCAGTTTTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 277
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 262}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155370826_1155370828 4 Left 1155370826 18:25098436-25098458 CCTCATTTTTTTTTTATTAAAAA 0: 1
1: 8
2: 90
3: 845
4: 6096
Right 1155370828 18:25098463-25098485 CTGCAAACACCAGTTTTGGAAGG 0: 1
1: 0
2: 0
3: 14
4: 262
1155370825_1155370828 5 Left 1155370825 18:25098435-25098457 CCCTCATTTTTTTTTTATTAAAA 0: 1
1: 0
2: 60
3: 865
4: 6821
Right 1155370828 18:25098463-25098485 CTGCAAACACCAGTTTTGGAAGG 0: 1
1: 0
2: 0
3: 14
4: 262

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155370828 Original CRISPR CTGCAAACACCAGTTTTGGA AGG Intronic
900615009 1:3561515-3561537 CTGCAGACACCAGGCCTGGATGG + Intronic
906330909 1:44883527-44883549 CTGCTGAGCCCAGTTTTGGATGG - Intronic
907506075 1:54919145-54919167 CGGCAAACAGCAGTGGTGGACGG + Intergenic
907602277 1:55783545-55783567 CGGCAAACAGCAGTGGTGGATGG + Intergenic
907861860 1:58361545-58361567 CTGCAAACCACAGTTTTGTTAGG + Intronic
909569679 1:77095038-77095060 CTGCAAAGAGCAGTTTTGAAAGG - Intronic
913375167 1:118143730-118143752 CTACAGACACCAGGATTGGAGGG - Intronic
914769140 1:150667970-150667992 CTACAAAGAGGAGTTTTGGAAGG - Intronic
916509706 1:165461216-165461238 CTGGAAAAACCAGGTTTGGAGGG - Intergenic
920231065 1:204469842-204469864 CTGCCAACGTCAGTTCTGGAGGG + Exonic
920420803 1:205832087-205832109 CTGCAAAGCACAGATTTGGATGG + Intronic
920639855 1:207741518-207741540 CGGCAAACAGCAGTGGTGGACGG + Intergenic
922876304 1:228942512-228942534 CGGCAAACAGCAGTGGTGGACGG - Intergenic
922877767 1:228953890-228953912 CGGCAAACAGCAGTGGTGGATGG - Intergenic
923068557 1:230542186-230542208 CTGCAAACACCAGTGATTCATGG + Intergenic
1062804242 10:405055-405077 GTGCAACCATCAGTTTTGGATGG - Intronic
1062980266 10:1716533-1716555 CTTTAAACAACTGTTTTGGAGGG - Intronic
1064680141 10:17803058-17803080 CTGAAAACACCATTTCTGAAGGG + Intergenic
1065244755 10:23745954-23745976 TTACAAACACCACTTTTTGAAGG + Intronic
1065467363 10:26038852-26038874 CTTCAAAATCCAGTTTTTGAGGG + Intronic
1068791298 10:61034052-61034074 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1068792074 10:61039517-61039539 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1069117679 10:64528358-64528380 TTGCAATCCCCAGTGTTGGAGGG + Intergenic
1071326730 10:84525734-84525756 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1071331542 10:84565570-84565592 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1072342225 10:94463593-94463615 ATTTCAACACCAGTTTTGGAAGG + Intronic
1072460344 10:95612602-95612624 CTTCATACAGCACTTTTGGATGG - Intronic
1074828334 10:117230758-117230780 ATTCAAACAACAGTTTTGCAGGG + Intergenic
1076243962 10:128932007-128932029 CTGCAAACCACAGTTCTGCAAGG + Intergenic
1076424293 10:130356594-130356616 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1077295440 11:1824219-1824241 CTGCACAAACCTGCTTTGGAAGG - Intergenic
1080084089 11:28258103-28258125 CTGCAAAAACCAGTTTTACTGGG - Intronic
1081070858 11:38606845-38606867 CAGCAAACAGCAGTGGTGGAAGG - Intergenic
1081090500 11:38860140-38860162 CTGCAAACAGCATTCTTGGTTGG + Intergenic
1084878722 11:72154300-72154322 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1085049793 11:73374482-73374504 CTGCAACCCCCAGGTTAGGAGGG - Intergenic
1085363368 11:75913752-75913774 TTGTAACCACCAGTTTAGGAAGG - Intronic
1087163602 11:94975230-94975252 GTACAAACACAAGTGTTGGAGGG - Intronic
1088242923 11:107789629-107789651 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1088465813 11:110137127-110137149 GTGCAAACTCCAGTTTTGTTTGG - Exonic
1089210204 11:116795257-116795279 CAGAAAACACCAGTATTGGCCGG + Intergenic
1092264783 12:6972484-6972506 ATACAAATACAAGTTTTGGAAGG - Intronic
1094600014 12:31900549-31900571 ATTCCAACATCAGTTTTGGAGGG - Intergenic
1094859648 12:34448095-34448117 TTGGAAACACCATTTTTGTAGGG - Intergenic
1095073294 12:37884613-37884635 TTAGAAACACCAGTTTTGTAGGG - Intergenic
1096351238 12:50902861-50902883 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1097380093 12:58884606-58884628 CTGCAAAGCTGAGTTTTGGAAGG - Intronic
1097915472 12:65016421-65016443 CAGGAAACACCAGGTTAGGATGG - Intergenic
1098984869 12:77001448-77001470 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1100171398 12:91978826-91978848 TTTCCAACACGAGTTTTGGAGGG - Intergenic
1100849395 12:98693637-98693659 TTGGAAACAACATTTTTGGAAGG + Intronic
1102839750 12:116106033-116106055 CTGCCAACATGAGTTGTGGAGGG + Intronic
1103645585 12:122389851-122389873 CTGTCAACACCAGTGCTGGAGGG + Intronic
1109601683 13:64639241-64639263 CTTCCAACATGAGTTTTGGAGGG - Intergenic
1109680720 13:65748471-65748493 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1109990005 13:70041861-70041883 CTGACAACACCACTGTTGGATGG + Intronic
1110888844 13:80673116-80673138 CTTCTAACCCCAGTTTTTGAGGG + Intergenic
1111820395 13:93206892-93206914 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1111910276 13:94303076-94303098 CAGCAAACAGCAGTGGTGGATGG + Intronic
1113579557 13:111419374-111419396 TTGCAATCACCTGTTTTGAAGGG - Intergenic
1114337505 14:21707086-21707108 TTGCAAACAACCTTTTTGGAGGG - Intergenic
1114384823 14:22243779-22243801 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1118311396 14:64696238-64696260 CTGCTAACCCCATTTTTAGAAGG + Intergenic
1118678443 14:68214100-68214122 CTGCAAACAACAGTTGTCCAGGG - Intronic
1119089946 14:71772217-71772239 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1120074854 14:80144383-80144405 CTTCAAAAACCAGACTTGGAGGG + Intergenic
1120107987 14:80517978-80518000 CAGCAAACAGCAGTGGTGGACGG + Intronic
1121852381 14:97233513-97233535 CTGCCAACAGGAGCTTTGGAAGG + Intergenic
1122955911 14:105070978-105071000 CTTCAGACACCAGTCATGGAGGG + Intergenic
1125275756 15:37989707-37989729 CTACAAAGAACAGTTTTGGAAGG + Intergenic
1126124630 15:45284217-45284239 CTGCAATGACCTATTTTGGATGG - Intergenic
1128601336 15:68997857-68997879 CTGCACACACATGTTTTGGAGGG + Intronic
1128781423 15:70361298-70361320 CTGCCCACACCAGGGTTGGAGGG + Intergenic
1129776379 15:78239329-78239351 CGGCAAACAGCAGTGGTGGACGG + Intronic
1131673844 15:94651138-94651160 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1132311978 15:100863921-100863943 CAGTAAACACCAGTTTCCGATGG + Intergenic
1135666816 16:24342886-24342908 CTGCAGTCACCAGTTTTTAATGG - Intronic
1136278843 16:29195571-29195593 CAGAAAACATCAGTTTTGTAAGG + Intergenic
1138516421 16:57537556-57537578 CTGCAAAAACCAGTTCAGAAGGG - Intergenic
1139616482 16:68097585-68097607 CTGGAAACAACAGTATTGCAAGG + Intronic
1140109940 16:71995303-71995325 TTGGCAACACCTGTTTTGGAAGG + Intronic
1141298453 16:82791595-82791617 CAGCAAACAACAGTGGTGGATGG - Intronic
1141373319 16:83507101-83507123 CTGCTCACACCAGGTTTGGGGGG - Intronic
1142083241 16:88161690-88161712 CAGAAAACATCAGTTTTGTAAGG + Intergenic
1143068341 17:4267331-4267353 CAGCACCCACCAGGTTTGGATGG + Intergenic
1146267202 17:31460646-31460668 CTGCTACCACTAGTCTTGGAGGG - Intronic
1147503056 17:40984357-40984379 CTGTAAACACCCATTTTGGGGGG - Intronic
1148117597 17:45186123-45186145 ATCCTAACACTAGTTTTGGAGGG - Intergenic
1148826730 17:50399327-50399349 CAGCAAACAGCAGTAGTGGACGG + Intergenic
1149113065 17:53057925-53057947 CTTCAAAAACCAATTGTGGAGGG + Intergenic
1149243112 17:54673775-54673797 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1149670383 17:58403050-58403072 TTCCAAACACCAGTTTTAAAAGG + Intronic
1150752308 17:67876393-67876415 CTGAAAACACCAGTTTAACAGGG + Intronic
1152242120 17:79166212-79166234 AAGCAAACACCAGTGTGGGAGGG + Intronic
1153400773 18:4682045-4682067 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1153402050 18:4692000-4692022 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1155370828 18:25098463-25098485 CTGCAAACACCAGTTTTGGAAGG + Intronic
1156027910 18:32677243-32677265 CTCCAAACTCCCATTTTGGAGGG - Exonic
1157259332 18:46165103-46165125 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1158152293 18:54386967-54386989 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1158455000 18:57598290-57598312 ATGCAATCTCCAGTGTTGGAGGG + Intergenic
1158493860 18:57935221-57935243 CTGAAAGCACCAGTTTTCGGAGG + Intergenic
1162464740 19:10832884-10832906 CTGCACACTCCCGTTTTGGCAGG + Exonic
1164173170 19:22745520-22745542 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1164579396 19:29425253-29425275 CTGCAAACACCAGGATTCAAGGG - Intergenic
1164935414 19:32206641-32206663 TTGGAAACCCCAGTTTTGGTGGG - Intergenic
1168147019 19:54425248-54425270 CGGCAAACAGCAGTGGTGGACGG + Intronic
925023807 2:592583-592605 CAGCAAACAGCAGTGGTGGAGGG - Intergenic
926204850 2:10828759-10828781 CTGGAAACCCCTGCTTTGGAGGG + Intronic
926723347 2:15979103-15979125 CTCAAAACACCATTTTTGGCTGG - Intergenic
929542353 2:42832094-42832116 CGGCAAACAGCAGTGGTGGACGG - Intergenic
931038980 2:58275750-58275772 CGGCAAACAGCAGTGGTGGACGG - Intergenic
931273228 2:60720946-60720968 ATCCTAACACAAGTTTTGGAGGG - Intergenic
932917171 2:75872053-75872075 CGGCAAACAGCAGTGGTGGATGG - Intergenic
933377739 2:81501664-81501686 CTGCCAACACCTATTTTAGAAGG - Intergenic
935748347 2:106209327-106209349 CAGCAAACAGCAGTGGTGGATGG - Intergenic
936249802 2:110859682-110859704 CTGCAAACAAGAGGGTTGGATGG + Intronic
936868889 2:117109655-117109677 CGGCAAACAGCAGTGTTGGATGG - Intergenic
939134088 2:138273520-138273542 CGGCAAACAGCAGTGGTGGACGG + Intergenic
940533425 2:154908206-154908228 CTGCATGCACAAGTTTTGGAAGG + Intergenic
940889815 2:159024412-159024434 CTGCAAACTCCATTTGTGGTAGG + Intronic
942580696 2:177413017-177413039 CGGCAAACAACAGTGGTGGATGG + Intronic
945683770 2:212944320-212944342 ATGTAAATTCCAGTTTTGGATGG + Intergenic
947218439 2:227770232-227770254 CTGCAAAGTCCACTTATGGAAGG + Intergenic
1171292986 20:23993338-23993360 CTGCAGACACCAGATTGGGCAGG + Intergenic
1171500797 20:25591493-25591515 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1172899243 20:38321801-38321823 CTGCAAAGACAAGGGTTGGAGGG - Intronic
1172947191 20:38698744-38698766 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1175571007 20:60022062-60022084 CTGCAGACATCAGTTGGGGAAGG - Intronic
1177263980 21:18760153-18760175 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1177359363 21:20048656-20048678 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1177895730 21:26854808-26854830 CGGCAAACAGCAGTGGTGGAAGG - Intergenic
1177896702 21:26861644-26861666 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1177912170 21:27046298-27046320 CTTCAAATACCAATTTTGGGAGG + Intergenic
1184167358 22:42737885-42737907 CTGCACCCAGCAGTTTTGGTGGG - Intergenic
1184178124 22:42801399-42801421 CAGCAAACATCAGTTGTGGGTGG - Intronic
949811676 3:8012972-8012994 CAGCAAACAGCAGTGGTGGATGG + Intergenic
950204132 3:11064955-11064977 CTGCCCACACCAATTTTGGCTGG + Intergenic
951016256 3:17735811-17735833 CAGCAAACAGCAGTGGTGGATGG + Intronic
951030439 3:17875684-17875706 ATGCAAACAAAACTTTTGGAAGG - Intronic
951591925 3:24275670-24275692 CGGCAAAAACCAGAGTTGGATGG - Intronic
953458641 3:43063721-43063743 CTCCAAACACTCCTTTTGGAGGG - Intergenic
955087754 3:55719857-55719879 ATGCAAACATCATTGTTGGATGG + Intronic
955751946 3:62192328-62192350 CTGCAAACATCTGTTCTGAAGGG - Intronic
956126009 3:66011510-66011532 CAGCCAACACAAGTCTTGGAGGG - Intronic
956884241 3:73542924-73542946 TGGCAAACTCCAGTTATGGAAGG - Intronic
957000509 3:74877945-74877967 CAGCAAACAGCAGTGGTGGATGG + Intergenic
957114449 3:76007000-76007022 CTGGAAATACCAGTTTTTAAGGG + Intronic
957296912 3:78344277-78344299 CGGCAAACCCCAGTGGTGGATGG + Intergenic
957687039 3:83515284-83515306 CAGCAAACAGCAGTGGTGGACGG - Intergenic
958043330 3:88252213-88252235 TTGCAAATATCAGTGTTGGAGGG - Intergenic
958424501 3:93965270-93965292 CGGCAAACAGCAGTTGTGGACGG - Intronic
958696947 3:97539757-97539779 CTGCTAACTCCAGTCTTGAAAGG - Intronic
959161776 3:102732820-102732842 CGGCAAACAACAGTGGTGGATGG + Intergenic
960006990 3:112790777-112790799 CGGCAAACAGCAGTGGTGGATGG + Intronic
961581812 3:127889375-127889397 CCCTTAACACCAGTTTTGGAAGG - Intergenic
961929725 3:130520417-130520439 AAGAAAAAACCAGTTTTGGAAGG - Intergenic
963575885 3:147060149-147060171 CGGCAAACAGCAGTGTTGGACGG - Intergenic
965044495 3:163558418-163558440 CTGCAAACAACCATTTTGAAAGG + Intergenic
965481853 3:169228454-169228476 ATGCAAAAACCAGTTTTTCACGG + Intronic
966353265 3:179054718-179054740 CGGCAAGCAGCAGTGTTGGATGG - Intronic
969162615 4:5274794-5274816 CGGCAAACAGCAGTGGTGGACGG - Intronic
970105879 4:12583575-12583597 ATGCAAACATTATTTTTGGAAGG - Intergenic
970282116 4:14468656-14468678 CTACACACACCAGTTCTGGAGGG + Intergenic
970408961 4:15789554-15789576 TTTCAAACATGAGTTTTGGAGGG - Intronic
972766775 4:42158571-42158593 CGGCAAACAGCAGTGGTGGACGG + Intergenic
974487853 4:62526898-62526920 CAGCAAACAGCAGTGGTGGACGG + Intergenic
975313230 4:72926028-72926050 CGGCAAACAGCAGTGGTGGACGG + Intergenic
975418825 4:74138679-74138701 CAGCAAACAGCAGTGGTGGATGG + Intronic
975836517 4:78428050-78428072 CCCCAAAAGCCAGTTTTGGAGGG - Intronic
977079962 4:92513087-92513109 CAGTACACACCAGTTTAGGAAGG - Intronic
977251317 4:94692625-94692647 CGGCAAACAGCAGTGGTGGACGG - Intergenic
978139940 4:105307016-105307038 CTGCAAACACCTGCTTTGATTGG - Intergenic
979885618 4:126024418-126024440 ATGCAAACACAAGTGTTGGTGGG + Intergenic
980190519 4:129519325-129519347 CAGCAAACAGCAGTGGTGGACGG - Intergenic
980386303 4:132090774-132090796 CAGCAAACAGCAGTGATGGATGG + Intergenic
980523646 4:133961712-133961734 CAGCAAACAGCAGTGGTGGACGG - Intergenic
980625711 4:135372297-135372319 CGGCAAACAGCAGTGGTGGATGG - Intergenic
981354616 4:143774245-143774267 CTGCAAGCACCACATATGGATGG - Intergenic
982886242 4:160786398-160786420 CTACAAAAAACAGTTGTGGATGG - Intergenic
983667444 4:170196968-170196990 CGGCAAACAGCAGTGGTGGATGG + Intergenic
983691900 4:170481116-170481138 CTGCAAAAGACAGTTTTGCAGGG + Intergenic
987700689 5:21394188-21394210 ATGCAAATACCAGTGTTTGAGGG - Intergenic
988740545 5:34064672-34064694 CGGCAAACAGCAGTGGTGGATGG + Intronic
988957400 5:36332981-36333003 CGGCAAACAGCAGTGGTGGATGG + Intergenic
991948333 5:71923351-71923373 CTGCCAAAACAAGTGTTGGAAGG + Intergenic
992293493 5:75304574-75304596 CGGCAAACAGCAGTGGTGGATGG - Intergenic
992421394 5:76609196-76609218 CTGTTAAGACCATTTTTGGATGG + Intronic
995853235 5:116568989-116569011 CAGCAAACACTTGTTATGGATGG + Intronic
997356186 5:133264479-133264501 CTGCAGACACCAGGCTTGGGGGG + Intronic
997974719 5:138434034-138434056 ATGTAAACACCAATGTTGGACGG - Intronic
998520945 5:142799890-142799912 TTTCAAACATGAGTTTTGGAAGG + Intronic
999903960 5:156118901-156118923 CTAGAATCACCAGTTTTGGCTGG - Intronic
1000103844 5:158040240-158040262 CTGCATACACCAGTTCCAGATGG - Intergenic
1000187014 5:158869041-158869063 CAGAAAACACCAGTCCTGGACGG - Intronic
1004137746 6:12984422-12984444 GTCCAAACATCAGTTCTGGAAGG - Intronic
1004236359 6:13878455-13878477 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1005324148 6:24682705-24682727 CGGCAAACAGCAGTGGTGGATGG + Intronic
1005392780 6:25350250-25350272 CTGCAAACTCTAGTATTTGAGGG - Intronic
1006744688 6:36333170-36333192 CTCCAAGCACCAGTATGGGAAGG + Intronic
1008582777 6:52921518-52921540 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1009702457 6:67201713-67201735 CGGCAAACAGCAGTGTTGGATGG - Intergenic
1011540395 6:88421360-88421382 CGGCAAACAACAGTGGTGGACGG + Intergenic
1011739209 6:90342597-90342619 ATGCAAACATGAGGTTTGGAAGG + Intergenic
1013021753 6:106228254-106228276 CGGCAAACAGCAGTGGTGGATGG - Intronic
1013566070 6:111364230-111364252 CTGAAAATAACAGTTTTGTAGGG + Intronic
1014208910 6:118687752-118687774 CGGCAAACAGCAGTGGTGGACGG - Intronic
1015632764 6:135247944-135247966 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1015980174 6:138830547-138830569 GGGCAAAAACCAGTTTAGGATGG - Intronic
1016367581 6:143336400-143336422 CTGCCATCACCTGTTCTGGAGGG - Intronic
1016531231 6:145059802-145059824 CTGGAAACAACAATTCTGGATGG + Intergenic
1019930266 7:4218075-4218097 CAGGAAAACCCAGTTTTGGAGGG + Intronic
1020821479 7:12973320-12973342 CTGCACACTCCATTTTTTGATGG - Intergenic
1021545984 7:21813182-21813204 CAGCAAACAACAACTTTGGATGG - Intronic
1021885344 7:25131953-25131975 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1022096861 7:27146688-27146710 CTTCATACACCTGTCTTGGAGGG - Intronic
1022117652 7:27276465-27276487 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1022197795 7:28085598-28085620 TTGTAAACCCCATTTTTGGAGGG - Intronic
1022827733 7:34033644-34033666 CTTCAAAGACCAGTATTGAAGGG - Intronic
1024148021 7:46536784-46536806 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1027366951 7:77468397-77468419 GTGCAAACAGCATTTTTAGATGG + Intergenic
1028013983 7:85684105-85684127 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1028288017 7:89028411-89028433 CTTCAAACACCAGTTGAGGTTGG + Intronic
1028587731 7:92468311-92468333 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1028736622 7:94220379-94220401 CTGCAAATACCTGGTTTAGAAGG + Intergenic
1028773093 7:94649616-94649638 ATGCAAACAGCAGTTTGAGATGG - Intronic
1028993385 7:97074790-97074812 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1029959621 7:104675877-104675899 TTGCATCCAGCAGTTTTGGAGGG - Intronic
1031250879 7:119378956-119378978 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1031299569 7:120047464-120047486 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1032099644 7:128963272-128963294 CTCCAAACCCCATCTTTGGAGGG + Intronic
1034248764 7:149671695-149671717 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1034249490 7:149676815-149676837 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1034650848 7:152688867-152688889 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1034707081 7:153155210-153155232 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1034859422 7:154583017-154583039 CTGCAAACACCTGCTCTTGATGG + Intronic
1034965015 7:155385412-155385434 CGGCAAACAGCAGTGGTGGACGG + Intronic
1036398881 8:8390837-8390859 CTCCAAACACCACTTCTGGCAGG - Intergenic
1037424231 8:18737673-18737695 TTGCAAATATCAGTTTCGGAGGG + Intronic
1038106205 8:24437606-24437628 ACGGAAACACCAGGTTTGGAGGG + Intergenic
1038274529 8:26109444-26109466 CTGCCATCACCAGCCTTGGATGG + Intergenic
1039604321 8:38868084-38868106 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1040955277 8:52973792-52973814 CTGCCATCACCAGTGTGGGATGG + Intergenic
1041322092 8:56623945-56623967 CTTCATGCACCAGTTTGGGAAGG - Intergenic
1042364335 8:67919108-67919130 CTGCAGACCCCAGGTTTGGCTGG - Intergenic
1043121686 8:76333112-76333134 CTCCAACCACCAGATTTTGAGGG - Intergenic
1045664320 8:104468926-104468948 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1045788640 8:105955560-105955582 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1045903032 8:107307911-107307933 GAGCAAACACCTGGTTTGGAAGG - Intronic
1047276649 8:123410761-123410783 CAGCAAACAGCAGTGGTGGACGG - Intronic
1047647734 8:126886575-126886597 CTGTAATCTCCAGTGTTGGAGGG + Intergenic
1051699196 9:19801422-19801444 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1055472456 9:76626606-76626628 CTGCACACATCAGTTTTCAAGGG - Intronic
1057179724 9:93023224-93023246 CTGGAAAGACCCGTCTTGGATGG - Intronic
1057744104 9:97737937-97737959 CTGCAAACAGCAGCTGAGGATGG - Intergenic
1060710441 9:125858545-125858567 CTGGAAATACCACTTTTGAATGG - Intronic
1061379670 9:130246823-130246845 TTTCAAACACGTGTTTTGGAAGG - Intergenic
1061414426 9:130438625-130438647 TGGCAAACACCCTTTTTGGATGG - Intergenic
1188067372 X:25678803-25678825 CTGCTAAAACCAGTTGTGGCAGG - Intergenic
1191141234 X:57118659-57118681 CTGCAGACACCAGCTTTGTGGGG + Intronic
1191142838 X:57134383-57134405 CTGCAGACACCAGCTTTGTGGGG + Intergenic
1191167488 X:57405562-57405584 CGGCAAACAGCAGTGGTGGATGG + Intronic
1192853931 X:74987161-74987183 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1192960997 X:76130737-76130759 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1193172388 X:78350375-78350397 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1193295496 X:79827570-79827592 CTGCAAACAGCAGTGGTGGAAGG + Intergenic
1195259091 X:103115404-103115426 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1196287281 X:113897473-113897495 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1196293149 X:113967225-113967247 CTTCAAACATGAGATTTGGAAGG + Intergenic
1196772529 X:119309158-119309180 CGGCAAACACCAGTGGTGGATGG + Intergenic
1197999720 X:132420349-132420371 CGGCAAACAGCAGTGGTGGATGG + Intronic
1199704996 X:150416710-150416732 CTGCTACCACCAGCTTTGGAGGG - Intronic
1200169685 X:154063589-154063611 ATGCAAACAACTGTTTTGGGGGG + Intronic
1200306847 X:155034591-155034613 CTGTTAAAAACAGTTTTGGAAGG - Intronic
1201421473 Y:13804542-13804564 CAGCAAACAGCAGTAGTGGAGGG - Intergenic
1201475228 Y:14374570-14374592 CTGTAATCACCAGTTGTGCAGGG + Intergenic
1201492162 Y:14554066-14554088 CATCAAACACAAGTTTTTGAAGG - Intronic