ID: 1155374062

View in Genome Browser
Species Human (GRCh38)
Location 18:25136994-25137016
Sequence GAGACAGAGGAGGATCCTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 269
Summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 245}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155374062_1155374065 -8 Left 1155374062 18:25136994-25137016 CCAAAAGGATCCTCCTCTGTCTC 0: 1
1: 0
2: 3
3: 20
4: 245
Right 1155374065 18:25137009-25137031 TCTGTCTCCTTGTAACCCCCAGG 0: 1
1: 0
2: 0
3: 9
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155374062 Original CRISPR GAGACAGAGGAGGATCCTTT TGG (reversed) Intronic
900837196 1:5014075-5014097 GAGGCAGAGGCAGCTCCTTTTGG - Intergenic
901132943 1:6973929-6973951 CTGACAGAGGAAGTTCCTTTTGG - Intronic
902902049 1:19524462-19524484 CCGAGGGAGGAGGATCCTTTGGG - Intergenic
903912786 1:26740285-26740307 GAAACACAGGAGGATCCTTTAGG - Intronic
906574357 1:46874648-46874670 AAGACAGGGGAGCATCCTTCTGG - Intergenic
906597614 1:47093256-47093278 AAGACAGGGGAGCATCCTTCTGG + Intronic
907707069 1:56841495-56841517 GAGAAAGCTGAGGATCCTGTGGG - Intergenic
908165042 1:61449454-61449476 GTGACAGAGGAGAATCCTGAGGG + Intronic
911142349 1:94519011-94519033 GGCACAGAGGAAGATCCTTCTGG + Intergenic
911182846 1:94876339-94876361 GATAGAGAGCAGGATTCTTTGGG + Intronic
916679494 1:167090957-167090979 GGGACTGAGGGGGTTCCTTTTGG - Intergenic
917083810 1:171285304-171285326 GAGCCAGATGTGGATCCGTTAGG - Exonic
917268642 1:173249057-173249079 GAAACAGTGGATGATCTTTTAGG + Intergenic
918384703 1:183993940-183993962 AAGACAGAAGAGAAGCCTTTTGG + Intronic
918400132 1:184154557-184154579 GAGACTGAGGAGGAGCCATGAGG - Intergenic
919040623 1:192383099-192383121 GAGACAGAAAAGAGTCCTTTGGG - Intergenic
920922277 1:210308046-210308068 GGGAAAGAGGATCATCCTTTTGG - Intergenic
921214410 1:212924867-212924889 GAGACAGAGCCGGATCCTCTGGG - Intergenic
922544503 1:226445824-226445846 CAGACAGAAGAGGCTCTTTTTGG + Intergenic
924292593 1:242553081-242553103 GATACAGATGTGGATCCTTGTGG + Intergenic
1063037279 10:2298848-2298870 GAGACTGAGGATCATCCATTTGG + Intergenic
1063165066 10:3454259-3454281 GAGACAGAACAGAATCCATTGGG - Intergenic
1063281030 10:4629361-4629383 AAGAGAGATGAGGATCCTTGGGG - Intergenic
1063428604 10:5968403-5968425 GTGACAGAGGAGAAGGCTTTGGG - Intronic
1063741304 10:8823391-8823413 GAGAAAGAGAGAGATCCTTTAGG - Intergenic
1063781676 10:9332121-9332143 GACACAGACAAGGATTCTTTTGG - Intergenic
1064194112 10:13231566-13231588 GGGACAGAGGACGCTTCTTTAGG - Intronic
1064656050 10:17557379-17557401 GGGAAAGAGGAGGATCATTTGGG - Intergenic
1068856032 10:61798275-61798297 AAGACAGAGGAAGACCCTTGTGG - Intergenic
1069597624 10:69682578-69682600 GGGCAAGAGGAGGATCATTTTGG + Intergenic
1072188207 10:93061520-93061542 GAGACTGAGGAGGGTCCAGTGGG - Intronic
1076651606 10:131993121-131993143 CAGCCAGATGAGGAACCTTTTGG - Intergenic
1077331389 11:1985236-1985258 GAGAAACAGGAGGAACCTTCTGG - Intergenic
1080774264 11:35371145-35371167 GAGACAAAGTAGGTTGCTTTAGG - Intronic
1081035310 11:38136911-38136933 GAGACAGAGGTGGGCCCTCTGGG - Intergenic
1081142882 11:39524677-39524699 GAGATAGAGGAGGAAACTTCTGG - Intergenic
1082181650 11:49127444-49127466 AAGACAAAGGAGGTTCCTTGAGG - Intergenic
1084041026 11:66542836-66542858 GAGGCAGAGGAGGACCCATTGGG + Intronic
1084953063 11:72677279-72677301 GAGACAGAGGAGGGGCCGTCTGG - Intergenic
1085072097 11:73556109-73556131 CAGACGCAGGAGGATCATTTGGG + Intronic
1086038448 11:82445135-82445157 GAGCCAGAGGAGGAGCTGTTAGG - Intergenic
1087831862 11:102827083-102827105 GATAGAGATGAGGATCCTGTTGG - Intergenic
1088845880 11:113666580-113666602 TAGACAAAGAAGGATACTTTAGG - Intergenic
1090189221 11:124757606-124757628 GTGACAGATGAGAATCATTTGGG + Intronic
1090409981 11:126501400-126501422 GAGACTAAGGAGGCTCCTCTGGG + Intronic
1202814370 11_KI270721v1_random:40412-40434 GAGAAACAGGAGGAACCTTCTGG - Intergenic
1092489256 12:8930513-8930535 GAGACAGGGGAGGCTCCTGGAGG - Exonic
1096946537 12:55414024-55414046 GAGACAGGGGAGGCTCCTGGAGG + Intergenic
1097329695 12:58319299-58319321 GAGAGAGATGAGGAACTTTTTGG - Intergenic
1099801301 12:87460258-87460280 GAGACAAAGCAAGTTCCTTTTGG + Intergenic
1100524589 12:95407628-95407650 GCAACAGAGCAGGATCCTGTGGG + Intergenic
1102533143 12:113561619-113561641 GAGGAAGAGGAGGAGGCTTTGGG + Intergenic
1103884394 12:124189844-124189866 GACACAGAGGAGGAGGCTGTGGG - Intronic
1104366769 12:128185125-128185147 GGGACAGAGGAGGATTCTTTAGG - Intergenic
1104623050 12:130332819-130332841 GGGAGAGAGGAGGATCTTTGAGG + Intergenic
1105258687 13:18762748-18762770 GAGACAGAGGTAGATCCTCTTGG + Intergenic
1105263696 13:18798636-18798658 GAGGCAGAGGCAGATCCTCTTGG + Intergenic
1110267254 13:73552423-73552445 AAGACAGAGAAGTATCATTTAGG + Intergenic
1111467551 13:88635938-88635960 TAGACACAGAAGGATTCTTTGGG - Intergenic
1113174967 13:107553745-107553767 GAGACAGAAGAGGCTCTGTTTGG - Intronic
1113356620 13:109587206-109587228 GACACAGGGGAGGAGCCTTGTGG + Intergenic
1114895230 14:26981359-26981381 GAGGCAGAGGAGAAAGCTTTTGG + Intergenic
1118713999 14:68546401-68546423 GAGACAGGGTAGGAACCTTCAGG + Intronic
1119379512 14:74219561-74219583 GACACAGAGGGGGCTCCGTTTGG + Intergenic
1119553175 14:75531797-75531819 GAGGCAGAGAAGGATGCTTACGG + Intronic
1120344473 14:83267864-83267886 GAGACAGAGGGGTATTCTTGAGG + Intergenic
1121025378 14:90611867-90611889 GAGACAGACGTGGTTCTTTTTGG - Intronic
1121109452 14:91302901-91302923 GAGACAGAAGAGAACCCTTAGGG + Intronic
1121148530 14:91607826-91607848 GAGACAAGGGAGGAGCCATTAGG - Intronic
1121180516 14:91925442-91925464 GAAACAGAGGAGCATGCTTGGGG - Intronic
1121458092 14:94051983-94052005 CAGACTGAGGTGGAACCTTTTGG - Intronic
1121504001 14:94462347-94462369 GAGACAGAGCAGGGACCTTGTGG - Intergenic
1121780297 14:96617850-96617872 GTGACTGAAGAGGAGCCTTTGGG + Intergenic
1122808382 14:104274039-104274061 GAGACAGAGAAGGATACTCAGGG - Intergenic
1126031449 15:44503559-44503581 GAGACAGAGGAAGGTCATTGAGG - Intronic
1126652734 15:50941691-50941713 GAGCCAGAGTAGGATCCTGTTGG - Exonic
1127863034 15:63010310-63010332 GAGAGAGTTGATGATCCTTTTGG - Intergenic
1129224940 15:74163781-74163803 CTGAGACAGGAGGATCCTTTGGG + Intergenic
1129583571 15:76838436-76838458 GAGTCATAGGAGCTTCCTTTGGG - Intronic
1131516207 15:93078876-93078898 GCCACAAAGGAGGATCCTTGGGG - Intronic
1131788287 15:95936530-95936552 GATAGAGAAGAGGATTCTTTGGG + Intergenic
1131921595 15:97334037-97334059 GGGACAGAGGAGGTTGCTTATGG + Intergenic
1132488742 16:212796-212818 GTGACAGAGCAAGATCCTCTCGG - Intronic
1133895116 16:9919775-9919797 GAGCCAGAGGAGCATGCATTTGG - Intronic
1136178097 16:28532385-28532407 GAGTCTGGGTAGGATCCTTTCGG + Intergenic
1139808471 16:69590828-69590850 GAGACAAAGGAGAATCTTTCAGG + Intronic
1140483119 16:75273312-75273334 GAAACACAGGCGCATCCTTTCGG - Intergenic
1141083749 16:81076946-81076968 GGGCCTGAGGAGGATCCGTTGGG - Intronic
1142713279 17:1734956-1734978 CAGAGAGAGGAGGTTGCTTTGGG + Intronic
1145965026 17:28910965-28910987 GGGAATGAGGAGTATCCTTTTGG - Intronic
1146473961 17:33146783-33146805 GAGAAGGAGGAGGATGCATTTGG + Intronic
1147178150 17:38669519-38669541 AAGACAGAGGCGGGACCTTTGGG + Intergenic
1148551185 17:48551575-48551597 GAGACTGAGGAGAATCCTCGGGG + Intronic
1149466185 17:56881489-56881511 GAGACAGAGTTGCATTCTTTTGG + Intergenic
1150229402 17:63541896-63541918 GAGACAGATGTTGAGCCTTTAGG + Intronic
1151718822 17:75844538-75844560 CAGCCAGAGGAGGGTCCTGTAGG - Exonic
1153119671 18:1706095-1706117 GAAACTAAGGAGGATCCTTCTGG - Intergenic
1153572718 18:6489295-6489317 GAGACAGAGCAGGAACCCCTGGG + Intergenic
1154191089 18:12231571-12231593 CAGACAGAGGAGTTTCCTTCAGG + Intergenic
1154424667 18:14262758-14262780 GAGGCAGAGGCAGATCCTCTTGG - Intergenic
1154427348 18:14282100-14282122 GAGGCAGAGGCAGATCCTCTTGG - Intergenic
1154430074 18:14301636-14301658 GAGGCAGAGGCAGATCCTCTTGG - Intergenic
1154432362 18:14317983-14318005 GAGGCAGAGGCAGATCCTCTTGG - Intergenic
1155374062 18:25136994-25137016 GAGACAGAGGAGGATCCTTTTGG - Intronic
1155557325 18:27034157-27034179 CAGACACAAGAGGATCCATTTGG - Intronic
1155581964 18:27318867-27318889 GAGGCAGAAGAGTATGCTTTGGG - Intergenic
1155874000 18:31062643-31062665 AAGACAGAGGAGAACCCTTGGGG + Exonic
1156450575 18:37264153-37264175 GAGACAGAGGCCCATCCTTGGGG - Intronic
1157478420 18:48037676-48037698 GAGACACAGATAGATCCTTTTGG + Intronic
1159869201 18:73741309-73741331 GAGAGAGAGGAGGATCACTGTGG - Intergenic
1163816891 19:19471879-19471901 CAGGCAGAGGAGGCTGCTTTTGG + Intronic
1163928172 19:20364775-20364797 GAGACAAAGGATGATTCTATGGG - Intergenic
1165061011 19:33205190-33205212 GAGACAGAAGAGCCTCCCTTCGG - Intronic
1165761731 19:38325715-38325737 GAGAGAGGGGAGCATTCTTTGGG + Intronic
1166437926 19:42785411-42785433 GAGAAAGAGGAGGGTCCTCATGG - Intronic
1166456880 19:42949203-42949225 GAGAAAGAGGAGGGTCCTCATGG - Intronic
1166466829 19:43040074-43040096 GAGAAAGAGGAGGGTCCTCATGG - Intronic
1166486631 19:43219689-43219711 GAGAAAGAGGAGGGTCCTCATGG - Intronic
1166493745 19:43283136-43283158 GAGAAAGAGGAGGGTCCTCATGG - Intergenic
1166856457 19:45784721-45784743 GAGACAGAGGGGTCTCTTTTAGG + Intronic
1168509746 19:56964965-56964987 GAGAGGCAGGAGGATCATTTGGG + Intergenic
925519282 2:4723585-4723607 GAGACACAGGAGGAGCCTCATGG - Intergenic
925605479 2:5655679-5655701 CAGAATGAGGAGGATCCTTGGGG - Intergenic
927019229 2:18999940-18999962 GAGAAAGTGGAGAATCATTTGGG - Intergenic
928359361 2:30650178-30650200 GAGACAGGGGAGAGGCCTTTAGG - Intergenic
931234024 2:60398457-60398479 GAGATAGAGGAGAATTCTTAGGG - Intergenic
932595270 2:73089432-73089454 GGGTCAGAGCAGGAGCCTTTGGG - Intronic
935109713 2:100081378-100081400 GAGACAGAAGAGGATGCCTCTGG + Intronic
936125261 2:109783831-109783853 GAGACAGAAGAGGATGCCTCTGG - Intergenic
936163195 2:110100372-110100394 GAGTGCGGGGAGGATCCTTTGGG + Intronic
936219432 2:110587637-110587659 GAGACAGAAGAGGATGCCTCTGG + Intergenic
936733107 2:115407414-115407436 AAGACAGAGGGGGCTGCTTTGGG + Intronic
937587989 2:123579413-123579435 GAGAAAGATGATGATCCTATAGG + Intergenic
939875338 2:147571366-147571388 GAGACAGTGGAGAATCATTCTGG + Intergenic
943334522 2:186597884-186597906 GACATAGAGGGGGATGCTTTCGG - Intronic
944517895 2:200530644-200530666 GAGACAGAGGAGGAACAGGTAGG + Intronic
944653911 2:201858896-201858918 GAGTCAAAGGAGGAGCGTTTTGG - Intronic
1172210124 20:33191396-33191418 GGGTAAGAGGAGGATGCTTTGGG + Intergenic
1172502932 20:35439702-35439724 GAGAGAGAGGAGGATATTTCAGG - Intronic
1173729831 20:45320355-45320377 GTGACAGAGGGAGACCCTTTGGG + Intergenic
1173764697 20:45596789-45596811 GAGACAGAGCAAGAACCTATGGG + Intergenic
1174074285 20:47921353-47921375 GACACAGAGGAGGGTCCTTTGGG - Intergenic
1174111738 20:48202059-48202081 GTGACAGAGGAGGCTCCTAGAGG - Intergenic
1174143926 20:48437448-48437470 GACACAGGGGAGGGTCCTTTGGG + Intergenic
1174457502 20:50660035-50660057 GAGACACAGGATGTTCCTGTTGG + Intronic
1175407275 20:58743385-58743407 AAGGCAGAGGAGGATGCTGTGGG + Intergenic
1176844674 21:13867768-13867790 GAGACAGAGGCAGATCCTCTTGG + Intergenic
1176847415 21:13887332-13887354 GAGACAGAGGCAGATCCTCTTGG + Intergenic
1177152839 21:17471665-17471687 AAGAAAGGGGAGGATCTTTTTGG + Intergenic
1180974241 22:19837993-19838015 GAGACGCAGGAAGATACTTTAGG + Intronic
1181100063 22:20533024-20533046 GAGACTGAGGAGTAGCCATTCGG + Intronic
1182321866 22:29482820-29482842 GAGACAGAGCATGATCTTTGGGG + Intronic
1182568874 22:31221124-31221146 GTGAGAGAGAAGGGTCCTTTGGG + Intronic
1183097706 22:35563298-35563320 GAGAAGGAGGAGGATGCTTTGGG + Intergenic
1183272129 22:36868755-36868777 GAGGCAGAGATGGATCCTCTGGG - Intronic
1183375372 22:37461734-37461756 GGGACAGTGGAGAATCCTTGGGG - Intergenic
1183520006 22:38291408-38291430 GAGGCAGAGGAGGAGCCTGGAGG + Exonic
1184919705 22:47597148-47597170 GAGACAGAGGAGGGACTCTTCGG - Intergenic
950215472 3:11155262-11155284 CCGAGAGAGGAGGATGCTTTGGG + Intronic
950330541 3:12152765-12152787 GAGACAGAAGAGAAGCCTTATGG + Intronic
950447322 3:13045778-13045800 GAGGCTGAGGAGGCTCCTGTAGG - Intronic
952904747 3:38132305-38132327 GAGAGAGAGAAGGATCCCTGTGG - Intronic
953654153 3:44835473-44835495 GAGGCAGGGGAGGATCACTTGGG - Intronic
956641892 3:71423455-71423477 GAGACAGAGGACACGCCTTTAGG - Intronic
958019978 3:87982908-87982930 GAAACAGATGAGGCTCCTTGAGG - Intergenic
958918061 3:100071732-100071754 GAGCCAGACAAGGATCATTTGGG - Intronic
961157871 3:124696102-124696124 GAGTCTGAAGAGCATCCTTTTGG + Intronic
961377076 3:126474382-126474404 GAGACAGAGGCCGAGCCTTGTGG - Intronic
963384972 3:144581195-144581217 GTGCCAGAGGAGGAGCCGTTGGG + Intergenic
965514940 3:169611174-169611196 GAGACAGAATGGTATCCTTTGGG - Intronic
966909746 3:184552474-184552496 GAGAGAGAGGAGTTTCATTTTGG + Intronic
967233239 3:187360729-187360751 GAAACAGAGGCAGATCATTTGGG - Intergenic
968920835 4:3521469-3521491 GTGACAGAGGATGGACCTTTGGG - Intronic
969105244 4:4802623-4802645 GAGACACAGGAGGATCTGGTGGG - Intergenic
969166882 4:5323540-5323562 GAGAAAAAGGAGGTTCCTGTAGG + Intronic
971046017 4:22806106-22806128 GAGACAGTGGAGGAGCTTTTAGG + Intergenic
971638644 4:29099186-29099208 GAGACAGTGGATGATCCTAGAGG + Intergenic
973048228 4:45563368-45563390 GAGACAGAGAAGGATAGCTTTGG - Intergenic
973063158 4:45755297-45755319 TTGACAGAGAAGGATCCTTATGG + Intergenic
975973364 4:80069059-80069081 GAGAAAGATATGGATCCTTTTGG - Intronic
979166980 4:117546397-117546419 GAGATAAAAGAGGATCCTTCAGG - Intergenic
979698311 4:123639241-123639263 GAGACAGATGTGGGTCATTTTGG + Intergenic
981604223 4:146525389-146525411 GAGACTGAGGAAGGTCCTTCAGG - Intergenic
983875297 4:172868029-172868051 AGGCCAGAAGAGGATCCTTTGGG + Intronic
986210920 5:5671467-5671489 GAGACAGAGCAGGCTGCTTAAGG + Intergenic
986216253 5:5721893-5721915 GAGACAGAGGTGAACCCTTTGGG + Intergenic
987196685 5:15533876-15533898 GAGGCAAAGAAGGATGCTTTGGG + Intronic
988602646 5:32654180-32654202 AAGACAGAAAAGGATCCCTTTGG - Intergenic
989548885 5:42709153-42709175 GGGACAGAGCAAGATCCTGTGGG - Intronic
989738819 5:44744002-44744024 GAGACAGAGGAGGATATTCAGGG - Intergenic
991661829 5:68958490-68958512 GAAACAGAGGAGGATGGTATTGG - Intergenic
992265913 5:75018106-75018128 GAGAGATAGGAGGATCATCTTGG - Intergenic
992927251 5:81601337-81601359 GAGCAACAGGAGGATCCTTGTGG + Intronic
993856189 5:93078659-93078681 GAAACAGTGGAGGATCCGTGTGG + Intergenic
995588885 5:113677530-113677552 CAGACCTAGGAGGATGCTTTTGG - Intergenic
996531648 5:124533571-124533593 GAGTGAGGGGAGGATCCTTCTGG - Intergenic
996633600 5:125665345-125665367 GAGGTAGAGGAGTTTCCTTTTGG + Intergenic
997023691 5:130032722-130032744 GAGAGAGAGGTGTATGCTTTGGG + Intronic
997711376 5:136007530-136007552 GCCACAGAGAAAGATCCTTTGGG - Intergenic
998352517 5:141510919-141510941 GAGACAGAGGAAGATCAGGTGGG - Intronic
998521390 5:142804099-142804121 GAGACAGAACAGGAACTTTTAGG - Intronic
998541306 5:142984071-142984093 TAGAGTGAGGAGGATCCTTTAGG + Intronic
1002566661 5:180116016-180116038 CACACAGAGGAGGCTCCTCTGGG + Intronic
1003548691 6:7083165-7083187 AAGTCAGAGGAGGCTCCTATGGG - Intergenic
1003592185 6:7445692-7445714 GAGACAGAATGAGATCCTTTGGG + Intergenic
1004558257 6:16721164-16721186 GAGACAAATGAGGAACATTTGGG - Intronic
1004606099 6:17196283-17196305 GATGCAGAGGAGACTCCTTTGGG - Intergenic
1005507037 6:26478300-26478322 GAGCCAGAGAAAGAGCCTTTGGG - Intergenic
1007549200 6:42716099-42716121 GTGTCAGAGGAGGATCCCTGTGG + Intronic
1007568314 6:42870397-42870419 AAGACAGAGGAGGACCCGTTGGG + Intergenic
1008082358 6:47208008-47208030 TAGACAGAGGAGGAGCTGTTTGG + Intergenic
1008428240 6:51384096-51384118 GAGAGAGTGGAGAATCCTTTGGG + Intergenic
1009439688 6:63662320-63662342 GACACAAAGGAAGATCATTTTGG + Intronic
1009895675 6:69746215-69746237 GGCAGAGACGAGGATCCTTTTGG - Intronic
1015343164 6:132125719-132125741 GAGACTTAGGAGAAACCTTTTGG + Intergenic
1015773650 6:136792698-136792720 AAGAGGGAGGAGGGTCCTTTCGG - Intergenic
1017562199 6:155640352-155640374 GAGACAGAGGGTTATCCTTTTGG - Intergenic
1022059849 7:26782698-26782720 GAAAAAGAGGTGGAGCCTTTGGG + Intronic
1023760137 7:43457841-43457863 TACACAGAGGAGCATGCTTTAGG + Intronic
1024601161 7:50982768-50982790 GTGACAGAGCAGGATGCCTTTGG - Intergenic
1026342714 7:69447933-69447955 GAGCCAGAGGTGGGTGCTTTAGG - Intergenic
1026594400 7:71722297-71722319 GAGACAGAGGAGGAGGTTCTAGG + Intergenic
1027221411 7:76216610-76216632 GAGAGAGAAGAGGTTCATTTTGG + Intronic
1029185314 7:98734163-98734185 AAGGCAGAGGAGAATCCTGTAGG - Intergenic
1030527575 7:110672742-110672764 GAGTCAAAGGAGAATCATTTTGG - Intronic
1030591841 7:111491526-111491548 GAGACATAGGAGGAACCTGGGGG - Intronic
1030953956 7:115827403-115827425 GAGACAGAGGAGGAGGGTTCTGG + Intergenic
1031798741 7:126214394-126214416 GTCACAGAGGATGATCCTTCAGG + Intergenic
1031954910 7:127933006-127933028 GAGAAAGAAAAGCATCCTTTTGG + Intronic
1032403450 7:131639404-131639426 GGGATAGAGGAAGATGCTTTGGG + Intergenic
1033174479 7:139111925-139111947 GCAACAGAGGAAGATCCTTTTGG + Intergenic
1033359875 7:140631304-140631326 GAGAAAGAGAATGCTCCTTTTGG - Intronic
1034005895 7:147471900-147471922 AAGACAGAGGAGAAACGTTTGGG + Intronic
1035643751 8:1202709-1202731 GAGACTGAGGAGGAAGCGTTGGG - Intergenic
1036530804 8:9584789-9584811 GAGACAGAGTATGTTCCCTTTGG + Intronic
1037630488 8:20651294-20651316 GACACTGAGGAGCATCCTCTGGG + Intergenic
1037683663 8:21119477-21119499 GAGAAAGGGAAGGTTCCTTTGGG + Intergenic
1038532260 8:28328035-28328057 GAGAGAGAGATGGAACCTTTGGG - Intronic
1039047258 8:33461422-33461444 GATTCAGAGGAGGAAGCTTTTGG - Exonic
1039941913 8:42098479-42098501 GAGAATGTGGAGGATCATTTTGG - Intergenic
1040974506 8:53175139-53175161 GAGACACAGGAGGATGCCGTGGG + Intergenic
1041158039 8:55008020-55008042 GGGAAAGAGGAAGAGCCTTTGGG + Intergenic
1041296677 8:56363726-56363748 GAGACAGAGGAGGATCAATATGG - Intergenic
1042537287 8:69871307-69871329 GGGAGAGAGGAGGAAGCTTTTGG + Intergenic
1043566293 8:81552272-81552294 GAAACAGAGCAAGGTCCTTTAGG + Intergenic
1044418315 8:91961580-91961602 GAGACAGAAGAGCACCTTTTGGG + Intronic
1045231896 8:100313797-100313819 GAGACAGAAGTGGATGGTTTTGG + Intronic
1046561006 8:115837321-115837343 CACACAGAGGAGGACCCTATTGG + Intergenic
1047231983 8:123005338-123005360 GAGACAGAGAAGGTTCCACTTGG - Intergenic
1047507234 8:125489417-125489439 GTGATACAGGAGGTTCCTTTTGG + Intergenic
1053663702 9:40302277-40302299 GAGACAGAGGCAGAGCCTCTTGG - Intronic
1053914217 9:42932819-42932841 GAGACAGAGGCAGAGCCTCTTGG - Intergenic
1054375828 9:64448510-64448532 GAGACAGAGGCAGAGCCTCTTGG - Intergenic
1054520911 9:66074008-66074030 GAGACAGAGGCAGAGCCTCTTGG + Intergenic
1055915766 9:81398671-81398693 GTGACAGAAGAGAATGCTTTTGG - Intergenic
1057676954 9:97143525-97143547 GAGGCAGAGGCAGATCCTCTTGG + Intergenic
1057779454 9:98037588-98037610 GTGACAGAACATGATCCTTTAGG + Intergenic
1058189019 9:101890520-101890542 GAAACTGAAGAGGATCCTTGAGG + Intergenic
1059601996 9:115788841-115788863 GAGACAGAGGAGGTTCCTAGAGG - Intergenic
1059771561 9:117431240-117431262 GAGACAGGGGAGGGACCTTGGGG + Intergenic
1060673698 9:125493342-125493364 GAGACAGGGGAGGTTCCATTTGG - Intronic
1188893518 X:35638572-35638594 GAGGCTTAGGAGGATCCTTCAGG - Intergenic
1189358153 X:40327180-40327202 GACACAGAGGAGGGTCCCTGTGG + Intergenic
1189615129 X:42775370-42775392 CAGAGGGAGGAGTATCCTTTTGG - Intergenic
1191077939 X:56475755-56475777 GAGAAAAAGGAGGATCAGTTGGG - Intergenic
1192571055 X:72205324-72205346 TATACAGAAGAGGATCCTTCCGG - Exonic
1193640470 X:84005171-84005193 GAGACAGAGGAGGAAATTTTAGG + Intergenic
1199467094 X:148150525-148150547 GAGTAAGAGGATGATCCTCTGGG - Intergenic
1200303795 X:155005271-155005293 GAGACAGAGGAGAATATATTTGG + Intronic