ID: 1155376293

View in Genome Browser
Species Human (GRCh38)
Location 18:25161407-25161429
Sequence CTTTTTATGGACACAATGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 169}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155376288_1155376293 -5 Left 1155376288 18:25161389-25161411 CCAGAAAAAGAAATGCCACTTTT 0: 1
1: 0
2: 6
3: 67
4: 464
Right 1155376293 18:25161407-25161429 CTTTTTATGGACACAATGGAGGG 0: 1
1: 0
2: 0
3: 25
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155376293 Original CRISPR CTTTTTATGGACACAATGGA GGG Intronic
905901136 1:41582594-41582616 CTTTTTGTGGACTCAAAGGCAGG + Exonic
905914287 1:41674325-41674347 TGTTTTGTGGACACAAGGGATGG + Intronic
907774212 1:57497615-57497637 CTTTCTGTGTACACATTGGATGG + Intronic
909209295 1:72802968-72802990 CTGTTGATGGACACAAAGGTTGG + Intergenic
909771154 1:79423391-79423413 CTTTATATGGAAATAATGCACGG + Intergenic
910006272 1:82400956-82400978 CTTTTTATGCCCCCAAAGGAAGG + Intergenic
910358284 1:86388005-86388027 CATTTTATGGACACTTTGGAAGG - Intronic
910512672 1:88024137-88024159 CTTTTTATGGCCATCATGAATGG + Intergenic
911226293 1:95309101-95309123 CTTTTTATTGACAAGATGAATGG + Intergenic
918686007 1:187416537-187416559 CTTCTTAATGACACAATGAAAGG - Intergenic
919816113 1:201440759-201440781 ATTTTTATGAAGACAATGAATGG - Intergenic
922170127 1:223147124-223147146 GTTTATATGGAGACAATGGGGGG + Intergenic
1063379065 10:5572969-5572991 CTTTTTATGGCCACAAAGTCTGG + Intergenic
1065166588 10:22985497-22985519 CTTTTCATGGACAGAAAGGAAGG - Intronic
1068617606 10:59136945-59136967 CTTTTTGTCCACACAATGCAAGG - Intergenic
1071201513 10:83223968-83223990 CTTTATGGGCACACAATGGAGGG + Intergenic
1072767423 10:98106852-98106874 TTTTTTAAGGACACTTTGGAGGG - Intergenic
1072889006 10:99304819-99304841 CTTTTTATAGACACATGGGCAGG + Intergenic
1075224766 10:120618343-120618365 CTTTTTAAGGAAACACTGTAGGG + Intergenic
1079903594 11:26219129-26219151 CTTTTTTTGGTCACAATTCATGG - Intergenic
1080900931 11:36490160-36490182 CTTTTTGTCCACACAATGCAAGG - Exonic
1081248066 11:40794540-40794562 CTTTCCTTGGATACAATGGAGGG + Intronic
1083083932 11:60123156-60123178 CTATTTAGGAACAAAATGGAAGG + Intergenic
1086974543 11:93117066-93117088 CTATTTAGGAACAAAATGGAAGG - Intergenic
1087258946 11:95989288-95989310 CTTTGTTTGGACACCATTGAGGG - Intronic
1088381567 11:109199069-109199091 TTTTTAATGGAGAGAATGGAAGG - Intergenic
1090439028 11:126711169-126711191 CTTTTTATGGATCCAGTGGGTGG + Intronic
1090961495 11:131561457-131561479 TTCTTCATGGATACAATGGATGG - Intronic
1092532059 12:9352967-9352989 CTTTTTATGGACATATTGTGAGG + Intergenic
1093151916 12:15631652-15631674 CTTTTTATAGAAACAAAGGATGG - Exonic
1093679799 12:21988690-21988712 CATTTTATGAACTCAATGGTGGG + Intergenic
1093738997 12:22659046-22659068 CTATTCATGCACACAATGGCTGG + Exonic
1096299709 12:50416062-50416084 CTTTGAAAGTACACAATGGAAGG + Intronic
1096374357 12:51095988-51096010 TTTATTCTGGACACAATGAAAGG - Exonic
1097615094 12:61874859-61874881 CATTTTATAGACAGAAAGGAGGG - Intronic
1098636212 12:72786902-72786924 CTTTTTAGGGAAACAAAGTATGG + Intergenic
1102329603 12:112017678-112017700 CTGTTTAGGGACACAAAGGAGGG - Intronic
1103197242 12:119055403-119055425 CTTCTTATGGAAACCCTGGAGGG - Intronic
1105017731 12:132796303-132796325 ATTTTGATGGACACTATGGAGGG + Intronic
1105207728 13:18236841-18236863 CTCTTTAGGGATACCATGGACGG - Exonic
1106163236 13:27219166-27219188 CTTTTTCTGTAAACACTGGATGG - Intergenic
1106764295 13:32898354-32898376 ATGTTTATGGCCACAGTGGAAGG - Intergenic
1109458573 13:62625724-62625746 CTTTTTATGGACACAAGATAGGG + Intergenic
1110875079 13:80499467-80499489 ATTTTTACTGATACAATGGAGGG + Intergenic
1111150223 13:84243676-84243698 CTTTTCATGGATACTATGTAAGG - Intergenic
1112442913 13:99437690-99437712 CTTTTTTTGGACCAACTGGATGG - Intergenic
1112626344 13:101108729-101108751 CTTTAGATGGACCCCATGGAAGG + Intronic
1115142728 14:30191978-30192000 TTTTTTATGGCCAGAATGGATGG + Intergenic
1116477070 14:45352327-45352349 CTTCTTATGGACACAGAGAATGG + Intergenic
1118013220 14:61631456-61631478 CGTTTTATGGACACAAGGCAGGG - Intronic
1118018862 14:61690177-61690199 CTTTTCAAGGCCAAAATGGAAGG - Intergenic
1118736888 14:68707306-68707328 CTTCTTATGGACACACTGCCTGG + Intronic
1120581164 14:86251551-86251573 CTCTTTATTGACACAATAAACGG + Intergenic
1122728525 14:103777405-103777427 GTTTTGACAGACACAATGGATGG - Intronic
1123186287 14:106520377-106520399 CATTTTAGGGAAAGAATGGAAGG + Intergenic
1123414628 15:20086220-20086242 CTTTTCCTGGACACACAGGAAGG - Intergenic
1123433160 15:20235368-20235390 ATTTTTAGGGACAAAATGCATGG - Intergenic
1123523970 15:21093331-21093353 CTTTTCCTGGACACACAGGAAGG - Intergenic
1127151179 15:56077163-56077185 GCTTTGATGGACACAATGAAAGG + Intergenic
1130695497 15:86127476-86127498 GTGAGTATGGACACAATGGAAGG + Intergenic
1133191632 16:4137978-4138000 CTTTTGATTGACACAAAGGAAGG - Intergenic
1134363318 16:13553043-13553065 TTTTTTGTTGTCACAATGGATGG - Intergenic
1135672529 16:24387481-24387503 CTTTTTATGGACACAGGATAGGG + Intergenic
1135678374 16:24436518-24436540 CTTTTTATGGACACAGGATAGGG - Intergenic
1137050005 16:35701461-35701483 CTTTTTGTGGAATCAATGAAGGG + Intergenic
1137072687 16:35919258-35919280 CTTTTTGTAGACTCTATGGAAGG - Intergenic
1137073623 16:35933763-35933785 CTTTTTGTGGAATCTATGGAGGG - Intergenic
1139101919 16:63777829-63777851 ATTTTTATGGATAAAATGGTTGG - Intergenic
1141440185 16:84025161-84025183 CTTTTTCCGGACACACTGGTGGG + Intronic
1142033103 16:87848111-87848133 CTTTTTGTGGACAGAGTGAAAGG + Intronic
1203113071 16_KI270728v1_random:1464218-1464240 ATTTTTAGGGACAAAATGCATGG + Intergenic
1148177560 17:45580680-45580702 CCTTTTATGGAAAAAATGTAAGG - Intergenic
1149888210 17:60361979-60362001 CTTTGTATGGACATAGTAGAAGG - Intronic
1150747772 17:67829948-67829970 CCTTTTATGGAAAAAATGTAAGG + Intronic
1153503251 18:5769903-5769925 CTTTCTATGGCAACAATGAATGG - Intergenic
1155376293 18:25161407-25161429 CTTTTTATGGACACAATGGAGGG + Intronic
1157778743 18:50419011-50419033 CTTTCTATGGAAACAACAGAAGG - Intergenic
1158918001 18:62155766-62155788 CTATTTCTGGCTACAATGGATGG - Intronic
927710567 2:25323151-25323173 CTTTTTATCGATGCGATGGAAGG + Intronic
929182188 2:39053483-39053505 CTTTAAATGGACACACTGCATGG - Intronic
929338168 2:40777789-40777811 CTTTATATGGGCACAATCCATGG + Intergenic
930697928 2:54430763-54430785 TTGTTTATGGACACAAAGTAGGG - Intergenic
931612453 2:64116995-64117017 CCTTATATGGACACAATTCAGGG - Intronic
931811437 2:65858427-65858449 CTTTTTATGGGAACAAAAGAAGG + Intergenic
932862243 2:75306129-75306151 CTTTATCTAGACACAATGAAGGG + Intergenic
935180599 2:100687231-100687253 CTTTTTGTGGGCAGAATAGATGG - Intergenic
935285109 2:101557517-101557539 CTTATTATGGAGACAATGGGAGG - Intergenic
939215075 2:139226454-139226476 CTTTTTAAGGACACAGGGGATGG + Intergenic
939650645 2:144757923-144757945 GTATATATGGACACAATGAAGGG - Intergenic
941389321 2:164891714-164891736 ATTTTTATGGAAACGATGAAAGG + Intergenic
941496616 2:166212784-166212806 TCTTTTATGACCACAATGGAAGG + Intronic
942919131 2:181349667-181349689 CTGTTTATGTCCACAATGGCAGG - Intergenic
943444552 2:187967872-187967894 CTTTTTAGGGAAAGAATAGAGGG - Intergenic
945008877 2:205440586-205440608 CTCTTTCTGGAGACAGTGGATGG - Exonic
945112936 2:206380698-206380720 CTTTTAAAGAAGACAATGGAAGG - Intergenic
1169436570 20:5597818-5597840 CTTAGTATGGGCACAGTGGATGG - Intronic
1169780592 20:9306077-9306099 CCTTATATGGAGACAATGGAGGG - Intronic
1170421995 20:16202339-16202361 ATTTTTATGGAAAAAAAGGATGG + Intergenic
1173993076 20:47317821-47317843 CTTTTTACGGTCACACTGCAGGG - Intronic
1174784438 20:53419328-53419350 CTTTTTATCTTCAAAATGGAAGG + Intronic
1176691317 21:9913976-9913998 CATTTTATGGACACAGTGTAGGG - Intergenic
1176944221 21:14958622-14958644 ATTTTTATGGACACAGGGAAAGG + Intergenic
1177821031 21:26031184-26031206 ATGTGTATGGACACAGTGGAAGG - Intronic
1177832890 21:26159016-26159038 CATTTTATGGACATACTGCATGG - Intronic
1179059307 21:37965102-37965124 CTCTTTATGGACACAGAGGCTGG + Intronic
1179088006 21:38237551-38237573 GTTTTAGTGGCCACAATGGAGGG + Intronic
1179225321 21:39447746-39447768 TTTTCTGTGTACACAATGGAAGG + Intronic
1182214340 22:28703314-28703336 CTATTTTTGGAAACATTGGAGGG + Intronic
1182545478 22:31073344-31073366 CTTTTCCTGGACACACAGGAAGG + Intronic
1182747086 22:32614414-32614436 CTCTGTATGGACACAGTGGAGGG + Intronic
951181114 3:19660300-19660322 TTTTTTCTGGACATACTGGATGG - Intergenic
952356971 3:32593316-32593338 CTTTTTCTGAACACAATAGGTGG - Intergenic
952888896 3:38028506-38028528 CTGTTCATGGACATAATAGATGG - Intronic
953060477 3:39424239-39424261 CTTTTTATATACACAATATATGG + Intergenic
955531851 3:59881371-59881393 CTTTTAAGAGACACAAAGGAAGG + Intronic
955562561 3:60207711-60207733 CTTTTTATAGAAACAATGAGTGG - Intronic
956788990 3:72666113-72666135 CCTTCTATTGACACAATAGAAGG + Intergenic
959882164 3:111456177-111456199 CTAATTCTGGACACAATGGCAGG + Intronic
962048503 3:131787158-131787180 GTTTTTATAGACACCTTGGAAGG + Intronic
963703897 3:148661729-148661751 CATGTTAGGGACACAATGGAGGG + Intergenic
967279853 3:187811333-187811355 CTTTCTATGGACTCAATCTATGG - Intergenic
970596780 4:17607671-17607693 CTTTTAACGGAGACAAAGGATGG + Exonic
970627110 4:17898680-17898702 ATTTATATCCACACAATGGAAGG - Intronic
970987833 4:22178498-22178520 CTTTTTATGGAATGAATGGGTGG - Intergenic
971466239 4:26965110-26965132 CTTATTATAGCCACAGTGGAGGG + Intronic
973036032 4:45407782-45407804 ATTTTTGTGGACACAATGAAAGG - Intergenic
975266114 4:72369946-72369968 CTTTATATGGACACAAATAATGG + Intronic
976671140 4:87655018-87655040 CTTTTTAAGAACAAAATGGGAGG + Intronic
976886681 4:89993482-89993504 CTTTTAATGGAAAAAATGGAAGG + Intergenic
980363905 4:131774163-131774185 CATTTTATGGACACAGTGTAGGG - Intergenic
981353611 4:143761535-143761557 CTATTTATGCACACAATGACTGG - Intergenic
982423952 4:155234776-155234798 CTTTTTTTGGCCAAAATAGAGGG + Intergenic
985946237 5:3186185-3186207 CTTTTTCTGGAGAAAAAGGAAGG + Intergenic
986122032 5:4848349-4848371 CTTTTACTGAACACAATGGCAGG + Intergenic
992114944 5:73530994-73531016 CTATTTAGGAACAAAATGGAAGG - Intergenic
993746859 5:91610805-91610827 TTCTTTATGGACCCAATGGGAGG + Intergenic
994541186 5:101100021-101100043 CTTTTTATGGACTCATTGGCAGG + Intergenic
994578110 5:101607540-101607562 TTTTTTATAGACACAATTCAAGG - Intergenic
997917416 5:137941943-137941965 CATTTTATCAACAAAATGGAAGG - Exonic
998296310 5:140972630-140972652 CTTTTTATGGAGACTCTGAAGGG - Intronic
1000180099 5:158800757-158800779 CTTTTAATAGTCACAGTGGATGG + Intronic
1004226707 6:13791554-13791576 TATTTTATGGATAAAATGGAAGG - Intronic
1004669908 6:17785980-17786002 CATTTTAGGGACATAGTGGATGG - Intronic
1005285889 6:24326543-24326565 CTTTTTATTGATACAAATGATGG - Intronic
1009283329 6:61779283-61779305 TTTTTTATGGCCCCAATGGGAGG - Intronic
1011210546 6:84951482-84951504 CTTTTTCTAGACACAAAGGAAGG - Intergenic
1011950885 6:92962367-92962389 GAATTTATGGACACAATGAAAGG + Intergenic
1012171899 6:96026760-96026782 CTTTGTATTAACACAATGGCAGG + Intronic
1012171985 6:96028043-96028065 GTTTTTATGGGAAGAATGGAAGG + Intronic
1013008559 6:106098699-106098721 CTTTTTGTGGAAACACTGGGTGG - Intronic
1013845742 6:114448834-114448856 CTTTTTATCAACAGAATTGAGGG + Intergenic
1013890091 6:115016358-115016380 AATTTTATGGAAACATTGGAAGG + Intergenic
1015736538 6:136406200-136406222 CTCTTAATGGACTCAAAGGATGG + Intronic
1017940329 6:159047257-159047279 CTTCTTATTGACACAACTGATGG + Intergenic
1020025277 7:4895385-4895407 CTTTTTATGGACACAGGCTAGGG + Intergenic
1024389353 7:48789352-48789374 CATTTTGTGGAAAAAATGGATGG + Intergenic
1024758179 7:52561768-52561790 TATTTTATGGCCACAATGAATGG - Intergenic
1026164850 7:67900690-67900712 ACTTTTAGGGACACAAGGGAGGG - Intergenic
1027526067 7:79270201-79270223 GTTTTTATGGACAAATTGGTGGG - Intronic
1027617866 7:80446094-80446116 CTTTTTTTGTACACAATTCATGG - Intronic
1033002945 7:137526908-137526930 CTCTTTATGGATAAAGTGGATGG + Intronic
1035846348 8:2868937-2868959 GTATTGATGGACACATTGGATGG - Intergenic
1040997039 8:53412805-53412827 CTTTTAATGGACACATGAGAAGG - Intergenic
1041327473 8:56683975-56683997 GTTTCTGTGGACACAATGGTAGG + Intergenic
1041894703 8:62910098-62910120 CTTTTGATGGACAGAAAGTAAGG - Intronic
1042031409 8:64479780-64479802 CTTCTTATGGGCATGATGGATGG - Intergenic
1042895843 8:73666938-73666960 CTCTTTATGGCCACAATGAAGGG - Intronic
1043559376 8:81472691-81472713 CATTCTATTAACACAATGGAAGG - Intergenic
1045557350 8:103227336-103227358 CTGTTTAGGAACAAAATGGAAGG - Intronic
1045989098 8:108284981-108285003 CTTTTTATGGAGACACTCCATGG - Intronic
1046183575 8:110684260-110684282 AGTTTAATGTACACAATGGATGG - Intergenic
1046483905 8:114860125-114860147 CTTATTCTGTACACACTGGATGG + Intergenic
1047100949 8:121675301-121675323 TTTTTTAGGCACACAATGGGAGG + Intergenic
1049003524 8:139840828-139840850 CTGTTCATGGGCACAAGGGAAGG - Intronic
1049215200 8:141404621-141404643 ATTTGGATGGACAGAATGGACGG + Intronic
1051121949 9:13761219-13761241 GGTCTTAGGGACACAATGGATGG - Intergenic
1052170801 9:25393989-25394011 CATTTTATTCACTCAATGGATGG + Intergenic
1053628249 9:39900047-39900069 CATTTTATGGACACAGTGTAGGG - Intergenic
1053777809 9:41566280-41566302 CATTTTATGGTCACAGTGTAGGG + Intergenic
1054162728 9:61687237-61687259 CTTTTTGTGGAATCAATGAAGGG + Intergenic
1054215638 9:62350654-62350676 CATTTTATGGACACAGTGTAGGG + Intergenic
1054364243 9:64316143-64316165 CATTTTATGGACACAGTGTAGGG - Intergenic
1054671843 9:67804696-67804718 CATTTTATGGACACAGTGTAGGG - Intergenic
1055946083 9:81692145-81692167 ATTTTTATGCACACAATTAAAGG - Intergenic
1057936734 9:99246241-99246263 CTTTTTGTGGACACACAGTAGGG - Intergenic
1058070388 9:100595661-100595683 TTTTGTATGAACACAATGGCTGG - Intergenic
1058244438 9:102605158-102605180 CTTTTTATGGAAACTGTGAATGG - Intergenic
1188624966 X:32272794-32272816 CTTTTTCTGGACACGTAGGATGG - Intronic
1191228789 X:58077174-58077196 GTTTTTGTGGAAACTATGGAGGG - Intergenic
1193275663 X:79584349-79584371 GTTCATATGGACACAATGAAGGG - Intergenic
1196559676 X:117130278-117130300 CATTTTATGGACAGAAGGAAAGG + Intergenic
1198329251 X:135606313-135606335 CTTTTTCTAGACAAAAGGGAAGG + Intergenic
1198746146 X:139892583-139892605 CCTTTTATGGGTACAATGGTTGG - Intronic
1199574487 X:149300223-149300245 CTTTTTCTAGACACAAGGGTTGG - Intergenic
1199905488 X:152224971-152224993 GTCTTTATGAACACAAAGGATGG + Intronic