ID: 1155381845

View in Genome Browser
Species Human (GRCh38)
Location 18:25231320-25231342
Sequence CTGTGTTGGAGGAGGACAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 340
Summary {0: 1, 1: 0, 2: 5, 3: 23, 4: 311}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155381839_1155381845 10 Left 1155381839 18:25231287-25231309 CCTAAAAGGACGAAACAACAGAT 0: 1
1: 0
2: 1
3: 20
4: 189
Right 1155381845 18:25231320-25231342 CTGTGTTGGAGGAGGACAGCTGG 0: 1
1: 0
2: 5
3: 23
4: 311

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155381845 Original CRISPR CTGTGTTGGAGGAGGACAGC TGG Intronic
900555775 1:3279666-3279688 CTGTGCTGCAGGAGGGCAGAGGG + Intronic
901044076 1:6385248-6385270 CTTTGTTGGAGGAGGTGACCTGG - Intronic
901627844 1:10633794-10633816 ACGTGTTGGAGGAGGACATGGGG - Intergenic
902794934 1:18794892-18794914 CTGTGCTGCAGGCAGACAGCAGG - Intergenic
902973019 1:20068907-20068929 CTGTGTTGGAGAAGGACGTAGGG - Intronic
904886659 1:33743358-33743380 TTGTGATGGAGGAGGGAAGCTGG + Exonic
905166720 1:36087455-36087477 CTGAGCTGCAGGAGGACATCCGG + Exonic
905313758 1:37068091-37068113 ATGTTCTGGAGGAGCACAGCTGG + Intergenic
906034385 1:42741337-42741359 CTGTGGGGGAGGAAGCCAGCAGG - Intergenic
906293749 1:44636535-44636557 CAGTGCTGGAGGTGTACAGCAGG - Intronic
907279959 1:53340889-53340911 CTGTTTTGGAGGAGAGCAGGTGG - Intergenic
908496161 1:64696977-64696999 CTGTGCTGGAGGAGATGAGCAGG + Intergenic
912325017 1:108749062-108749084 AGGTGTTGGAGGTGGAAAGCAGG + Intronic
913550754 1:119915362-119915384 GGGTGCTGGAGGAGGTCAGCGGG - Exonic
915250774 1:154586734-154586756 CAGACATGGAGGAGGACAGCTGG + Intronic
917299953 1:173563002-173563024 CCCTGGTGGAGGCGGACAGCAGG + Intronic
917825741 1:178818566-178818588 CAGTGCTGGAGGCTGACAGCTGG - Intronic
919794069 1:201310703-201310725 CTGTGCTGCCTGAGGACAGCTGG - Intronic
920324059 1:205147702-205147724 CTGTGTTTGATGAGGAGTGCTGG - Exonic
921033431 1:211353884-211353906 CTGTGTTGAGGGAGGATACCAGG + Intronic
921180111 1:212625464-212625486 CTGTGTTTCAGGAAGACAGGAGG + Exonic
921582817 1:216914813-216914835 CTGTCTGGGCGGAGGACAGAGGG + Intronic
922719465 1:227892997-227893019 CTGGGCTGGAGGTGGTCAGCAGG - Intergenic
923907312 1:238399680-238399702 TTGTGTTGGAGGCGTACATCAGG - Intergenic
924112282 1:240711941-240711963 CTGATTTGGAGGAGGGCAGTGGG - Intergenic
1062886088 10:1017186-1017208 CTGTCTGGGAAGAGGAAAGCTGG + Exonic
1063232648 10:4080870-4080892 CTGGGTTGAAGGAGGTCATCAGG - Intergenic
1063643895 10:7859381-7859403 CTGAGTTTCAGGAGGGCAGCGGG + Intronic
1067095766 10:43298661-43298683 CTGTGGAGGAGGAGGACATAGGG - Intergenic
1069075779 10:64037132-64037154 CAGAGCTGGAGGAGGATAGCAGG - Intergenic
1069776152 10:70928467-70928489 CTGTGTTTGGGGAGGGGAGCAGG + Intergenic
1069840131 10:71334702-71334724 CTGTGGTGGAGGTGCACTGCGGG - Intronic
1070780588 10:79135424-79135446 CTCTGTTGGGGGAGGCCAGGAGG + Intronic
1072881225 10:99232020-99232042 CTGTCTTGGAGGCTGAGAGCTGG - Intronic
1073200101 10:101728304-101728326 CTGTGTTTATGGAGGACAGAGGG - Intergenic
1074184783 10:111091487-111091509 CTGTGCTGGAGGTCGACAGCAGG + Intergenic
1074463530 10:113661425-113661447 TTTTTTGGGAGGAGGACAGCTGG + Intronic
1074524000 10:114248964-114248986 ATGGGTTGGAGGAGGACCGGGGG - Intronic
1074796565 10:116951501-116951523 CTGTGTTGGAGATGCACAGAGGG + Intronic
1075786460 10:125053420-125053442 CTGTGTTGGGGGATGCCAGGAGG - Intronic
1076253075 10:128998074-128998096 CTGGGTTCCAGGAGAACAGCAGG - Intergenic
1076827924 10:132979349-132979371 CAGTGTTGGAGCAGGACTGCAGG - Intergenic
1076848510 10:133081734-133081756 CGGGGGTGGAGGAGGACACCAGG + Intronic
1077329277 11:1976838-1976860 CTGTGCTGGGGGTGGAGAGCAGG + Intronic
1078483773 11:11703525-11703547 TTGGGGTGGAGGAGCACAGCTGG - Intergenic
1080047802 11:27827283-27827305 CTTGGTTGGAGGAGGACACATGG + Intergenic
1080773379 11:35363309-35363331 CTGAGTAGGAGGCAGACAGCAGG + Intronic
1081739306 11:45426995-45427017 CTGTGGTTGAGGCTGACAGCGGG + Intergenic
1081999202 11:47383727-47383749 CTGACTTGCAGGAGGTCAGCAGG + Intergenic
1082733061 11:56824204-56824226 CTGTGTTGGAGGAGATTTGCAGG - Intergenic
1082926470 11:58552554-58552576 CTATGTTGTAAAAGGACAGCTGG + Intronic
1083715898 11:64576844-64576866 CTGGGTTGGGGGAGGCAAGCAGG - Intergenic
1083861626 11:65423124-65423146 CTGTGTGGAAGGAGGAAGGCAGG + Intergenic
1084214414 11:67639772-67639794 CTGTGCGGGAGGAGGGCAGGTGG + Intergenic
1084888874 11:72226832-72226854 TTGAGTGGGAGGGGGACAGCTGG + Intronic
1085387206 11:76164105-76164127 CTGGCTTGGAGGAGGAGAGAGGG - Intergenic
1086009522 11:82083307-82083329 CTTTGTTGGTGTAGGGCAGCTGG + Intergenic
1088096406 11:106105859-106105881 CTGAGATGGAGGAAGACAGAAGG - Intergenic
1088202088 11:107348949-107348971 CTTTGTTGGATGAAGACATCTGG - Exonic
1089621736 11:119726599-119726621 CTGAGTGGGTGGAGCACAGCAGG + Intronic
1090138288 11:124224064-124224086 CTTTGTTGGAGGAAAACAGTGGG - Intergenic
1090189188 11:124757441-124757463 CTGTGTTCAAGGAAGTCAGCTGG - Intronic
1202812256 11_KI270721v1_random:32017-32039 CTGTGCTGGGGGTGGAGAGCAGG + Intergenic
1091839147 12:3606978-3607000 CTGTTTTGAAGTAGGACAGGGGG - Intronic
1093141088 12:15511278-15511300 GTGTGTTGGAGGAGGAAAAGTGG - Intronic
1094074699 12:26459852-26459874 CTGGGTTGGAGGTGTACAACAGG - Intronic
1094275030 12:28664728-28664750 CAGAGTTTAAGGAGGACAGCAGG + Intergenic
1096581669 12:52589653-52589675 CTTTGATGGAGGAGGCCAGAAGG + Intronic
1097187347 12:57202903-57202925 CTGTGTTTGGGGAGGGGAGCGGG - Intronic
1097463694 12:59895868-59895890 TTTTGTTGGAGGAGGAAAGCAGG + Intergenic
1097920621 12:65068474-65068496 CTGTGTTGGAGGAGTGGAGAGGG + Intronic
1098230227 12:68365517-68365539 CTGCGGAGGAGGAGGAAAGCTGG - Intergenic
1103592882 12:122004711-122004733 GTGTGTTGGAGAATGACATCTGG - Intergenic
1103726352 12:122999206-122999228 CTGAGCTGGAGGAGGAAGGCTGG + Intronic
1104370544 12:128220291-128220313 CTGGCTTGGAGCAGGAGAGCTGG - Intergenic
1105730932 13:23214624-23214646 CAGGGATGGAGGAGAACAGCAGG - Intronic
1106020448 13:25909796-25909818 CTGAGTTGGGGGAGGGCGGCGGG - Intronic
1108632804 13:52302788-52302810 CTGTGGTGGATGAGGCCTGCAGG + Intergenic
1108653894 13:52509809-52509831 CTGTGGTGGATGAGGCCTGCAGG - Intergenic
1111454386 13:88461378-88461400 AAGTATTGGAGGAGGACAGAGGG + Intergenic
1112581343 13:100678872-100678894 GTGTGATGGAGGAGGATAGGAGG - Intergenic
1112596841 13:100815209-100815231 CAGTTTTGGAGCAGGACAGGCGG + Intergenic
1113649631 13:112026617-112026639 CTCTGCTGGAGGAGGACAGGTGG + Intergenic
1113692679 13:112322781-112322803 CTGTGCTGGGGGTGGGCAGCAGG + Intergenic
1113973539 13:114209217-114209239 CTGTGTTGGATGCGGACAGCGGG - Intergenic
1114763576 14:25345031-25345053 CTGTCTTTGAGGTGGACAGAAGG + Intergenic
1114902236 14:27077615-27077637 CTGTGTTGGAAGCAGAAAGCAGG + Intergenic
1115566866 14:34631697-34631719 CTGTGTTTTAGGAGGAAAACTGG - Intergenic
1115727545 14:36233567-36233589 CTGGGTTGGAGAGGGACAGCAGG + Intergenic
1116498719 14:45594193-45594215 CTATGATGGAAGTGGACAGCAGG + Intergenic
1117460405 14:55939447-55939469 CTGTGTCGGGGGAGGAGGGCAGG + Intergenic
1119684082 14:76616426-76616448 CTGTGTTGGAGGATGAGGACTGG - Intergenic
1119866808 14:77981140-77981162 CTGGGCTGGGGGAGGGCAGCAGG - Intergenic
1121081911 14:91115124-91115146 CAGTGCTGGAGGAGGGCAGCAGG + Intronic
1121629334 14:95411143-95411165 CTCTGTTGAAGGAGGATACCTGG - Intronic
1122691757 14:103534981-103535003 CTGTGATGGAGGAGCAGTGCTGG + Exonic
1122692440 14:103537685-103537707 CTGGGTGGGTGGAGGGCAGCAGG + Intergenic
1124118618 15:26869047-26869069 CTGTCCTGGGGAAGGACAGCGGG + Intronic
1124872905 15:33561295-33561317 CTGTGCTGGGGAAGAACAGCAGG + Intronic
1125905981 15:43393039-43393061 CTCTTTTGGAGGAGGAGACCAGG + Intronic
1126931663 15:53659497-53659519 CTGGGTGCGAGGTGGACAGCTGG + Intronic
1127920549 15:63491038-63491060 CAGAGTTAAAGGAGGACAGCGGG - Intergenic
1128765097 15:70246515-70246537 GGGTGTTGGAGCAGGACGGCGGG + Intergenic
1129029377 15:72607471-72607493 AGGAGTTGGAGGAGGACTGCAGG - Intergenic
1129088328 15:73121211-73121233 ATGTGTGGGAGGAGGACAGGCGG - Intronic
1129236172 15:74225044-74225066 CAGAGATGAAGGAGGACAGCAGG - Intergenic
1131111646 15:89768198-89768220 CTGAGTAGGGGGAGCACAGCGGG - Intronic
1133382462 16:5342644-5342666 CTGTGCTGGGGTAGGAGAGCTGG + Intergenic
1134231650 16:12434715-12434737 CTGTCCTGGATGAGGTCAGCAGG - Intronic
1135007335 16:18838094-18838116 CTATGGTGGAGGTGGCCAGCAGG - Exonic
1135855891 16:26009822-26009844 CTATGTTGCAGGAGAACTGCAGG + Intronic
1136110598 16:28062228-28062250 GTGTTTTGGAGGCAGACAGCCGG - Intronic
1136748084 16:32609779-32609801 GGGTGTGGGAGGAGGATAGCAGG - Intergenic
1137559439 16:49493322-49493344 CTGTGTGGGAGGTGGGCTGCAGG - Intronic
1138238743 16:55408923-55408945 CAGTGAGGGAGGAGGAAAGCAGG - Intronic
1140092797 16:71851518-71851540 CTGGCTTGGGGGAGCACAGCTGG - Exonic
1140134928 16:72197601-72197623 CAGTGGAGGAGGAGGGCAGCCGG - Intergenic
1140433421 16:74924553-74924575 AGATGTTGGAGGATGACAGCAGG - Intronic
1141251441 16:82362644-82362666 CTGTATTCTAGGGGGACAGCTGG + Intergenic
1203050221 16_KI270728v1_random:868986-869008 GGGTGTGGGAGGAGGATAGCAGG - Intergenic
1143109215 17:4544133-4544155 CTGGGGTGGAGGGGGACAGTGGG - Intronic
1143773165 17:9181149-9181171 CTTTGTTAGAGGAGGAGAGAAGG - Intronic
1144224517 17:13131893-13131915 GTGTGGTGGAGGAGTACACCAGG - Intergenic
1144569618 17:16388199-16388221 ATGCGTGGGAAGAGGACAGCTGG - Intergenic
1145216436 17:21056062-21056084 CTTTGTTTGAAGAGGACACCAGG + Intergenic
1145361824 17:22218345-22218367 ATGTGTGGGAAGAGGACATCTGG - Intergenic
1146931145 17:36778805-36778827 CTGTGCTGGAGGAGGGCAGCTGG - Intergenic
1148783976 17:50136219-50136241 CTGGGTTGGTGGGGGCCAGCAGG + Intronic
1148837196 17:50471639-50471661 CAGTGTTGGAGCAGGAAAGGAGG - Intronic
1149189530 17:54042810-54042832 CTGTCTTGGAGGTGGAGAGGAGG - Intergenic
1149554771 17:57565545-57565567 CTGTGATGGAGCAGGACAAAAGG - Intronic
1150288429 17:63967076-63967098 GTGTGATGAAGGAGGACAGGGGG + Intronic
1150433788 17:65139076-65139098 CTGGGGTGGAGGAGGGGAGCTGG - Intronic
1150727261 17:67661472-67661494 CTCTGTTGCAGGAAGACAGTGGG - Intronic
1150976343 17:70091401-70091423 CTGTGTTGGAGGAGGGTAGCTGG - Intronic
1151408908 17:73907721-73907743 CTCTGTTGGAGGAGGAGGACAGG + Intergenic
1151744527 17:76004843-76004865 CTGTGGTGGAGTAGCCCAGCTGG - Intronic
1152471905 17:80494190-80494212 CTGGAATGGAGGAGGGCAGCCGG - Intergenic
1152658004 17:81528879-81528901 CTGTGGCGAAGCAGGACAGCTGG - Exonic
1153659635 18:7315548-7315570 CTGGCTTGGAGGAGGGCAACTGG - Intergenic
1153718914 18:7881429-7881451 CCGTCTTGGAGTAGGGCAGCGGG + Intronic
1155381845 18:25231320-25231342 CTGTGTTGGAGGAGGACAGCTGG + Intronic
1159042780 18:63340899-63340921 CTGTGTTGTGGGAGGCAAGCAGG - Intronic
1159321147 18:66850737-66850759 CTATGTTGGAGGGGGATGGCTGG + Intergenic
1160042793 18:75360802-75360824 CTGGGGTGGAGGAGGTGAGCAGG + Intergenic
1160060447 18:75524864-75524886 GTGGGATGGAGGAGGACAACAGG - Intergenic
1160845482 19:1164293-1164315 TTGTGCTGGAGCAGGACAGGAGG - Intronic
1160931694 19:1573566-1573588 CTGTGATGGAGAAGGAAGGCAGG + Intergenic
1161585586 19:5103756-5103778 CTGTGTTGGAGAAGGATGGAGGG + Intronic
1162801409 19:13112765-13112787 CGGTGTTGGCGGGGAACAGCGGG - Exonic
1163519220 19:17781857-17781879 CTGTGTTGGGGGAGTCCAGCAGG + Intronic
1164558962 19:29275461-29275483 CTGTGCTGGGGAAAGACAGCAGG - Intergenic
1165468892 19:35991858-35991880 CTGTGTTGGAGGAAGCAAACTGG - Intergenic
1167449580 19:49559226-49559248 CTCTATTGGGAGAGGACAGCTGG - Intronic
925907421 2:8547726-8547748 GGGTGTTGGAGGAGGGCACCAGG - Intergenic
926012615 2:9420916-9420938 ATGTGTTGGAAGAAGACTGCGGG + Intronic
926297818 2:11581352-11581374 CTGATTTGGATGAGAACAGCCGG - Intronic
926695858 2:15769942-15769964 TTGTGCTGGAGGTGGACAGAAGG - Intergenic
926881026 2:17543408-17543430 TGGTTTTGGAGGAGGACAGATGG - Intronic
927040392 2:19224443-19224465 CTGTGTGGGCAGAGGCCAGCTGG - Intergenic
927198686 2:20565375-20565397 CTGTGTGGGAAGTGGACAGGAGG - Intronic
927697121 2:25246305-25246327 CTCTTCTGGAGGAGGAAAGCAGG + Exonic
928586911 2:32769109-32769131 CTGTGTTGGAAGAGAATAACAGG + Intronic
928713888 2:34037979-34038001 CTGTGTTGGGGGAGATCAGAGGG + Intergenic
929057912 2:37894454-37894476 CTGTCTTGATGGAGGAAAGCTGG - Intergenic
929609401 2:43258828-43258850 CTGTACTGGAGGAGAACAGCTGG - Intronic
929746068 2:44660193-44660215 CTGTCTTAGTGGAAGACAGCTGG + Intronic
930019654 2:46993872-46993894 CTGTGTTGGGGCAGGCAAGCAGG - Intronic
931757507 2:65387155-65387177 CTGTGTGGGAGGTGCACAGTGGG + Intronic
932460452 2:71878850-71878872 CTGTGTGTGGGGAGCACAGCTGG - Intergenic
933746817 2:85577721-85577743 CTGTGTCGGGGGAGGAGAGTTGG + Intronic
935312832 2:101802450-101802472 CTGTGTAGAAGGAGGAGAGGAGG - Intronic
935381042 2:102451440-102451462 CTGAGGAGGAGGAGGCCAGCAGG - Intronic
936243878 2:110809870-110809892 CTGTGTTAGGTGAGCACAGCAGG + Intronic
936529870 2:113268727-113268749 CTGGGATGGGTGAGGACAGCTGG + Intronic
937222810 2:120351843-120351865 CTGGGCTGGAGGTGGGCAGCTGG + Intergenic
938174051 2:129108021-129108043 CTATCTTGGAGGAGCACAGAAGG - Intergenic
938759102 2:134407693-134407715 GTATGCTGGAGGAGGAAAGCAGG + Intronic
938818956 2:134934329-134934351 TAGTATTGGAGGAGTACAGCTGG - Intronic
941622088 2:167789770-167789792 CTGTGGGGGAGGAGGAAAGGTGG - Intergenic
941687472 2:168461897-168461919 CTGTGATGGGGAAGGACAGGTGG + Intronic
942425363 2:175854875-175854897 CTCGGTTGGAGCAGGACAACTGG - Intergenic
942910709 2:181241063-181241085 CTGGGTTTGAGGAGCACAGCAGG - Intergenic
943089822 2:183360746-183360768 CTGTGTGGGAGCAGGAGAGAGGG + Intergenic
943560360 2:189454176-189454198 CTGTGTTGGAGAAGGGAGGCCGG + Intronic
944893574 2:204142157-204142179 CTGAGGTGGAGGAGGCCAGCAGG - Intergenic
945435010 2:209809054-209809076 CACTGTCGGATGAGGACAGCGGG + Intronic
947499767 2:230663523-230663545 GTGTGGTGGAGGAGAACAGGAGG - Intergenic
947543725 2:230995989-230996011 CTGGGATGAAGGAGGACACCAGG + Intergenic
948554261 2:238796409-238796431 CTGTGTGGCAGGAGGACAGCTGG + Intergenic
1169425191 20:5491291-5491313 CTGTGTTCCAGGAGGATAACAGG + Intergenic
1170080818 20:12472749-12472771 CTGTGTAGGAGGAAGACCACAGG + Intergenic
1170327345 20:15171296-15171318 CAGTGGTGGAGGAGGAGAGATGG - Intronic
1170400556 20:15978532-15978554 CTGTGGTGGAGCAGCCCAGCAGG + Intronic
1170703087 20:18721873-18721895 CTGTCCTGGAAGAGGACAGGTGG + Intronic
1171324224 20:24276633-24276655 CAGTGTGGGTGCAGGACAGCAGG + Intergenic
1173336810 20:42118764-42118786 CTGAGCAGGAGGAGGACAGAAGG - Intronic
1173396873 20:42688377-42688399 GTCTGTAGGAGGAGCACAGCAGG - Intronic
1175159018 20:56994325-56994347 CTGGGTGGGTGGAAGACAGCTGG - Intergenic
1175431686 20:58909498-58909520 CTGGTGGGGAGGAGGACAGCTGG - Intronic
1176049748 20:63112450-63112472 CCGTGGTGGAGGAGAACAGCAGG + Intergenic
1176386503 21:6140760-6140782 CTGTCTTGGAGGAGGCGGGCCGG + Intergenic
1176972899 21:15287568-15287590 GTGGGATGGAGGTGGACAGCTGG - Intergenic
1178271637 21:31195476-31195498 CTATGTTTGAGGACGACAGCTGG - Intronic
1178587221 21:33880625-33880647 CTGTATTGGAGATGGACAGGTGG + Intronic
1178895186 21:36551711-36551733 CTGTGCTGTAGGATCACAGCAGG + Intronic
1179358256 21:40682170-40682192 CTTTGTTGGAGGTGGCCAGAGGG + Intronic
1179736970 21:43397492-43397514 CTGTCTTGGAGGAGGCGGGCCGG - Intergenic
1180046127 21:45306599-45306621 AGGTATTGGAGCAGGACAGCGGG - Intergenic
1180162748 21:46005653-46005675 CTGGGCTGGAGGAGGGCAGCAGG + Intergenic
1181462398 22:23093523-23093545 CTATGGAGGAGGAGGACAGAGGG + Intronic
1181595205 22:23909821-23909843 CTGTGAGGGAGGAGATCAGCAGG - Intergenic
1182051246 22:27314521-27314543 CTGTGTTGGATGATGTCATCAGG + Intergenic
1182712831 22:32333270-32333292 CTGTGCTGGAAGTGGGCAGCAGG + Intergenic
1182803672 22:33052461-33052483 CTGTTTGGGAGGAGGAAAGGAGG + Intronic
1184434655 22:44463152-44463174 CTGTGTTGAAGGAGAACTTCAGG - Intergenic
1184815820 22:46868952-46868974 CTGTGTTGGAGCAGAACACAGGG - Intronic
1185275263 22:49947911-49947933 CTGTGTGGGGACAGGACAGCAGG - Intergenic
950088910 3:10280924-10280946 CTGTGTTAGAGGAGGAAAAGCGG + Exonic
951806247 3:26647213-26647235 ATGTGTTGGAGGGTGACAGAGGG - Intronic
952658301 3:35814505-35814527 CTATTTTGGTGGAGCACAGCTGG + Intergenic
954535256 3:51355037-51355059 CTGGGTGGGAGGAGGAGGGCAGG + Intronic
955072348 3:55582400-55582422 CACTGTTTGAGGAGGAGAGCAGG - Intronic
956861387 3:73327356-73327378 CTGTGTTAGAGATGGACAGTTGG - Intergenic
957335208 3:78818794-78818816 CTGTGATAGAGGGGGACTGCTGG - Intronic
958109897 3:89128938-89128960 CTATGTTGGAGGTAGACAGTGGG + Intronic
961409839 3:126712177-126712199 CTGTGTGTGAGAATGACAGCAGG + Intronic
961517282 3:127445817-127445839 CGGTGTTCCAGGAGGACTGCAGG + Intergenic
964091830 3:152886310-152886332 CTGTGTTGGAGGAGAGAAGGTGG + Intergenic
966868509 3:184275894-184275916 CGGTGTTGCTGGAGGGCAGCTGG + Intronic
967192505 3:186997025-186997047 CTGTGTTGGAGGCGGGCAGGTGG + Intronic
967385962 3:188911176-188911198 CTGTCTGGGAGGCTGACAGCTGG + Intergenic
967844886 3:194035538-194035560 TTGTGTGGGAGGAGGGCAGTGGG - Intergenic
967948971 3:194825618-194825640 CAGTGTTGAGGGAGGACAGATGG - Intergenic
968283161 3:197492246-197492268 CTGTGTTAGAGGAGGGGAGGAGG + Intergenic
968384703 4:125566-125588 CTGGGTTGGAGGAAGTCACCTGG + Intronic
968727034 4:2252552-2252574 CTGGGGTGGGGGAGGGCAGCAGG + Intronic
968949670 4:3684028-3684050 CTGTGGGGGAGGTGCACAGCTGG - Intergenic
969225977 4:5798593-5798615 GTGTGCTGGAGGAGGCCAGCCGG + Exonic
969856995 4:10008029-10008051 CTGTGTTGGAGTTGCACAGCTGG - Intronic
969887633 4:10229822-10229844 TTGTGATGGAGCAGGACAGTTGG + Intergenic
970051719 4:11922079-11922101 CTGTGTTGGAGTAAGAAGGCCGG - Intergenic
975829727 4:78356684-78356706 CCTTGCTGGAGGAGGAAAGCAGG - Intronic
975973637 4:80072226-80072248 CTGTGTGGGCGGAGATCAGCCGG - Intronic
977050917 4:92128117-92128139 CTGTATGGGAGGATGACATCTGG - Intergenic
977758314 4:100700235-100700257 CTGGGCTGGAGGAGGACAGATGG - Intronic
977916520 4:102600416-102600438 GTATTTTGGAGGAGGGCAGCAGG + Intronic
978934552 4:114359260-114359282 CTGTGTTGGTGGTGGACACAGGG - Intergenic
979324734 4:119365504-119365526 CAGTGTTGGAGGAGCAGATCTGG - Intergenic
982411867 4:155086643-155086665 CTCTGTGGGATGATGACAGCTGG + Intergenic
986335829 5:6754708-6754730 CAGTGTTGGAGCCAGACAGCAGG - Intronic
986407273 5:7438556-7438578 CTGTGGTTTAGGGGGACAGCAGG + Intronic
986445973 5:7821672-7821694 CTGTGCTGGAGGACTTCAGCTGG + Intronic
987331392 5:16860605-16860627 CTCTGTTAGAGGAGGACATTTGG - Intronic
994515175 5:100762201-100762223 CTGTTTGGAAGCAGGACAGCTGG - Intergenic
995523364 5:113031439-113031461 CTCCGCTGGAGGAGGACTGCTGG - Intronic
997527147 5:134560727-134560749 CTCTCTGTGAGGAGGACAGCAGG - Exonic
998170439 5:139869522-139869544 CTGTGCTGGAGAAGGGCAGGGGG - Intronic
999208772 5:149869679-149869701 CTGTGCTGCAGGAAGGCAGCTGG + Intronic
999758476 5:154682719-154682741 CTGGGCTGGGGGAGGACAGTGGG - Intergenic
999995763 5:157090813-157090835 GTATGTTGGAGGAAGACTGCAGG + Intronic
1001049651 5:168404156-168404178 CCCTGTTGGCAGAGGACAGCTGG + Intronic
1001228512 5:169965897-169965919 CTGTGCTGGAGGAGGAATCCAGG + Intronic
1002323118 5:178387455-178387477 CTGAGCTGCAGGAGGGCAGCAGG - Intronic
1004014062 6:11716379-11716401 CTCTGCTGGGGGAGGACAGCAGG + Intronic
1004777196 6:18860959-18860981 CTGTGTTGGAGGAATAATGCTGG + Intergenic
1006342183 6:33452858-33452880 CTGTGTTGGAGGAGGGGTGTTGG + Exonic
1006367090 6:33622019-33622041 CTGAGTTGGGGAAGGGCAGCCGG + Intronic
1006442284 6:34060072-34060094 CTGTGCAGGAGGCGGCCAGCTGG + Intronic
1007584662 6:42981976-42981998 CAGAGTTGTAGGAGGACAACTGG - Intergenic
1008285649 6:49646288-49646310 AGGTGGTGGAGGAGGAGAGCGGG + Intergenic
1011113519 6:83864862-83864884 ATGTATTGGAGGAGGTGAGCAGG + Intronic
1012477972 6:99635784-99635806 AGGTGTTGGGGGAGGACTGCAGG + Intergenic
1013166556 6:107598667-107598689 ATGGGTTGGAGGAGGGGAGCAGG + Intronic
1016932396 6:149424189-149424211 CAGAGTTGGGAGAGGACAGCAGG - Intergenic
1017821058 6:158049380-158049402 CAGTGTTGGAGCAGGACAGAGGG + Intronic
1018040704 6:159919430-159919452 CTGGGCTGGAGGAGGAAGGCAGG - Intergenic
1019020474 6:168913685-168913707 CTGTGCTGCAGGAAGACAGAGGG + Intergenic
1019631941 7:2054086-2054108 CTGTGTTGGGGGAGGTGGGCTGG - Intronic
1020788351 7:12595171-12595193 CTGTGGTGGAGCAGCTCAGCAGG - Intronic
1021121223 7:16797950-16797972 CTGTGTTTGGGGAAGACATCTGG + Intronic
1021857569 7:24872061-24872083 TTTTGTTGGAACAGGACAGCTGG - Exonic
1022379928 7:29850495-29850517 CCGAGCTGGAGGAGCACAGCAGG + Intronic
1024677335 7:51648508-51648530 CTGTATTGAAGAGGGACAGCAGG - Intergenic
1025239813 7:57261830-57261852 CTTTGTTGGAGAAGGAAAGGAGG - Intergenic
1025801322 7:64789218-64789240 AGGTGTGGGAGGAGGGCAGCAGG - Intergenic
1026841581 7:73672218-73672240 CGGTGTTGGACCCGGACAGCTGG - Intergenic
1029529704 7:101117258-101117280 CTGTGTTGGAGGAAAGCAGGAGG + Intergenic
1031955016 7:127934166-127934188 CTGTGTTGGGGGAGGGGAGTAGG + Intronic
1034193769 7:149230330-149230352 CTGTTTTGGAAGAGCACAGGAGG + Intergenic
1036608720 8:10331284-10331306 CTGGCTTGGAGGAGAACAACTGG + Intronic
1036652368 8:10653443-10653465 GTGTGTTGGAGGGAGACACCTGG - Intronic
1036694043 8:10963173-10963195 TTGTGGTGGAGAAGGCCAGCGGG - Intronic
1037603201 8:20416258-20416280 AAGTGTTGGAGGAGGAGAACCGG - Intergenic
1037821772 8:22138614-22138636 CAGTGTGGGAGGACGACAGGAGG - Intronic
1040600916 8:48883236-48883258 ATGTGGTGGAGGCGGGCAGCTGG - Intergenic
1040705299 8:50119034-50119056 CTGTGGTGGAGGCACACAGCTGG + Intronic
1040960619 8:53028231-53028253 CTCTCTTAGAGGATGACAGCTGG + Intergenic
1043077043 8:75715517-75715539 CTGTGCTGGAGCAGGACAAGGGG + Intergenic
1046276742 8:111971348-111971370 CAGTGTTGGAGGAGGGGACCTGG - Intergenic
1046291803 8:112172086-112172108 CAGTGTGGGAGGAAGACAGCCGG + Intergenic
1048302234 8:133260224-133260246 CTGTGTAGGTGGTGGACACCGGG + Intronic
1048330235 8:133466089-133466111 CTCTGTGGGCGGAGGACAGAAGG + Exonic
1048981348 8:139704504-139704526 CGGGGTTGGAGGAGGAAAACGGG + Intergenic
1049424509 8:142532136-142532158 CTGTGTAGGAGGAGGGGAGGAGG + Intronic
1049595486 8:143481428-143481450 CTGTGCTTGAGGAGAACACCTGG + Intronic
1049651525 8:143771952-143771974 CGGTGCTGAAGGAGGTCAGCGGG + Intergenic
1050156195 9:2668495-2668517 CTGCTTTGGTGGAGGACAGGAGG + Intergenic
1052405218 9:28051086-28051108 CTGTGTAGGAAAAGGAAAGCAGG - Intronic
1053383758 9:37670385-37670407 GTATGAGGGAGGAGGACAGCAGG + Intronic
1054922079 9:70553115-70553137 GTGGGATGGATGAGGACAGCAGG - Intronic
1056532212 9:87497871-87497893 CGGAGTGTGAGGAGGACAGCCGG + Exonic
1057304571 9:93904749-93904771 CGGGGATGCAGGAGGACAGCAGG + Intergenic
1058646832 9:107138838-107138860 CTGTGTTGGAGGATGGCCTCTGG + Intergenic
1059154650 9:111979022-111979044 TTGTGTTGCAGAAGGACTGCTGG - Intergenic
1059881889 9:118700139-118700161 CTGTGTTGGAAGAGTAGAGATGG - Intergenic
1059941180 9:119361361-119361383 CTGTGTTCCATGAGGACAGTGGG + Intronic
1060876810 9:127089832-127089854 CTCTGTGGCAGGAGGACAGGGGG + Intronic
1061442238 9:130613429-130613451 CTTTGTGGGAAGAGGATAGCTGG + Intronic
1062267321 9:135693105-135693127 CTGGGCTGGGAGAGGACAGCAGG + Intergenic
1062375241 9:136259101-136259123 CTGGGGTGGATGGGGACAGCCGG + Intergenic
1062579330 9:137222489-137222511 CTGTGAGGGAGGAGAACAGCCGG - Intergenic
1187133999 X:16529433-16529455 CTGTGTGGGAGGTGGGGAGCTGG - Intergenic
1187179670 X:16932016-16932038 CAGTGGTGGGGGAGGACAGCAGG + Intergenic
1190124903 X:47695652-47695674 TTGTGGTGGAGGAGGAGAGGAGG - Intergenic
1190487432 X:50941841-50941863 CTCTGCTGGTGGAGGACAGAGGG + Intergenic
1190580932 X:51892974-51892996 GTGTGTTGGGGGAGGAAAGGAGG - Intronic
1190744327 X:53312543-53312565 CTGTGCTGTGGGAGGACAGGAGG - Intronic
1193096789 X:77557919-77557941 CTCTGTAGGAGGAGGACAGCAGG + Intronic
1194598700 X:95892569-95892591 GTGTGTTGGGGGAGGAAGGCGGG + Intergenic
1195364936 X:104116483-104116505 CTATGTAGGTGGAGGACAGGAGG + Intronic
1195697428 X:107677228-107677250 CTGAGTGGGAGGGAGACAGCTGG + Intergenic
1196230837 X:113219117-113219139 CTGAGGTGGAGGAGGAGAGAAGG - Intergenic
1196884325 X:120228561-120228583 CTGTCTTGCAGATGGACAGCGGG + Intergenic
1197515606 X:127423973-127423995 CTGAGGAGGAGGAGGACAGAGGG - Intergenic
1198677357 X:139145085-139145107 CTGGGTTAATGGAGGACAGCTGG + Intronic
1198790698 X:140342465-140342487 CTGTGGTGGGGGAAGAAAGCAGG + Intergenic
1199546585 X:149012618-149012640 ATTGGTTGGAAGAGGACAGCTGG - Intergenic
1200317218 X:155146779-155146801 ATATGTAGGATGAGGACAGCTGG - Intronic
1201534577 Y:15031741-15031763 AAGTGTTGGAAGAGGACATCGGG + Intergenic