ID: 1155381932

View in Genome Browser
Species Human (GRCh38)
Location 18:25232244-25232266
Sequence TGCAGGTGAAATACCTAGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 116}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155381932_1155381937 15 Left 1155381932 18:25232244-25232266 CCTACCTAGGTATTTCACCTGCA 0: 1
1: 0
2: 0
3: 5
4: 116
Right 1155381937 18:25232282-25232304 TTCTTGCTACTTACCCTCTGGGG 0: 1
1: 0
2: 0
3: 17
4: 178
1155381932_1155381936 14 Left 1155381932 18:25232244-25232266 CCTACCTAGGTATTTCACCTGCA 0: 1
1: 0
2: 0
3: 5
4: 116
Right 1155381936 18:25232281-25232303 ATTCTTGCTACTTACCCTCTGGG 0: 1
1: 0
2: 0
3: 15
4: 149
1155381932_1155381935 13 Left 1155381932 18:25232244-25232266 CCTACCTAGGTATTTCACCTGCA 0: 1
1: 0
2: 0
3: 5
4: 116
Right 1155381935 18:25232280-25232302 AATTCTTGCTACTTACCCTCTGG 0: 1
1: 0
2: 0
3: 13
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155381932 Original CRISPR TGCAGGTGAAATACCTAGGT AGG (reversed) Intronic
901752649 1:11420863-11420885 TGCAGTTGCCATACCCAGGTGGG - Intergenic
903463471 1:23535422-23535444 TGTATGTAAAATACCTAGCTGGG - Intergenic
912116503 1:106413844-106413866 TGCAGGTGAGCAAACTAGGTGGG - Intergenic
913298776 1:117348285-117348307 TGCAAGCGAAATAGCAAGGTGGG - Intergenic
918146117 1:181757612-181757634 TGCTGTAGAAATACATAGGTAGG + Intronic
1063441191 10:6074721-6074743 TGCAGGTGGAAAAAGTAGGTAGG + Intergenic
1065543946 10:26800148-26800170 CTCAGGTGATACACCTAGGTTGG - Intronic
1068033443 10:51731412-51731434 TGCAGCAGAAATACCAAGGGTGG - Intronic
1068395526 10:56456770-56456792 TCCTGGTGAAATACTCAGGTTGG - Intergenic
1072232095 10:93422561-93422583 TTCAGGTGAAATACCCACCTTGG - Intronic
1073035384 10:100561296-100561318 TGCAGGTGATAGAGCTAGGAGGG + Intergenic
1075250128 10:120861422-120861444 TGCTGGGGAAACACCTAGGAGGG + Intronic
1077490005 11:2856654-2856676 TGCAGGTTAACTACCCAGGTGGG - Intergenic
1082126534 11:48438233-48438255 TGCAGATGACATAACTATGTAGG - Intergenic
1083654638 11:64223594-64223616 AGCAGGTGAAATGCCCAGCTGGG - Exonic
1087198572 11:95322655-95322677 TGCATGTGAAATATCTTAGTTGG - Intergenic
1088589419 11:111390536-111390558 TGCATGTAGAATATCTAGGTTGG - Intronic
1090738257 11:129631708-129631730 TGCTGGTGAAAGAGCTATGTGGG - Intergenic
1092005099 12:5062513-5062535 TTCAGGTGAAATACAACGGTTGG - Intergenic
1094333353 12:29320642-29320664 TGTAGCTAAAAGACCTAGGTTGG + Intronic
1096139538 12:49231494-49231516 TGCATGTGTAATACCTTGCTGGG + Intronic
1101451782 12:104786388-104786410 TGTATGAGAAACACCTAGGTAGG - Intergenic
1105658952 13:22471579-22471601 TGGAGGTGAAATGCCCAGTTTGG + Intergenic
1110110970 13:71745804-71745826 TGCAGGGAAAATACCTAGAGGGG + Intronic
1110200216 13:72840974-72840996 TGCAGGTCAGATACCAAGATTGG - Intronic
1110574803 13:77043256-77043278 GGCATGAGAAATACCTAAGTAGG - Intergenic
1112433758 13:99375743-99375765 TGCAAGTAAAATACCAAAGTGGG + Intronic
1113126201 13:106982064-106982086 TGGATATGAAATACCTGGGTGGG - Intergenic
1117094649 14:52284695-52284717 TGCAGGTGAAGATCCTTGGTAGG - Intergenic
1118801415 14:69192968-69192990 TGCAGGTGGAATTGCTGGGTGGG + Intronic
1121809749 14:96873979-96874001 TGCAGGTAAATTACATAGGAAGG - Intronic
1126798363 15:52278781-52278803 TGGAGGGGAGATATCTAGGTTGG - Intronic
1130738803 15:86576606-86576628 TGCACTTGAAATACCTAAGGAGG + Intronic
1130918556 15:88324925-88324947 GGCAGGTGAAACTCCTAAGTTGG + Intergenic
1135272985 16:21084978-21085000 TGCAGGTCAAAGTCCTAGTTAGG + Intronic
1138023558 16:53504754-53504776 AGCTGGAGAAATACCTATGTGGG - Intergenic
1138612619 16:58139053-58139075 TGCAGTTAAAATATCTAGATTGG + Intergenic
1141180162 16:81747181-81747203 TGCAGGAGAAATTCCTAGAGGGG - Intronic
1144817040 17:18041635-18041657 TGGAGGTGAGATCCCTGGGTGGG + Intronic
1151794762 17:76336501-76336523 GGCAGGTGGATTACCTGGGTCGG + Intronic
1155343402 18:24835681-24835703 TGCCTATGAAATACCTAGCTTGG + Intergenic
1155381932 18:25232244-25232266 TGCAGGTGAAATACCTAGGTAGG - Intronic
1157574356 18:48733689-48733711 TGCAAATGAAAACCCTAGGTGGG - Intronic
1158852085 18:61504663-61504685 TCCAGGTGAAACACTTAGCTAGG + Intronic
1160219981 18:76968042-76968064 TGCAGGTGAAACACCTCTGCCGG - Intronic
1162495258 19:11019837-11019859 TGTAGGGGAAAGGCCTAGGTGGG + Intronic
1165660866 19:37579042-37579064 TGCAGGTGAAATGTTCAGGTGGG - Intronic
1166402452 19:42493394-42493416 TCCATGTGTAATAACTAGGTAGG - Intergenic
1167978077 19:53248388-53248410 TACAGGTAAAACACCTACGTAGG - Intronic
1168126425 19:54285980-54286002 TGCAGCTGAAATGTCCAGGTGGG - Intergenic
1168175469 19:54624884-54624906 TGCAGCTGAAATGTCCAGGTGGG + Intronic
926367126 2:12143782-12143804 TGCAAGGGAAATACATAGGGAGG + Intergenic
929462995 2:42118303-42118325 AGCAGGAGAAAGACCTAGGGTGG - Intergenic
932844303 2:75119731-75119753 TGCAGGTGAAACACATGGGAAGG - Intronic
933057008 2:77683222-77683244 TGCATGTGAGGTATCTAGGTTGG - Intergenic
933927140 2:87104365-87104387 TGCATGTGAGGTATCTAGGTTGG - Intergenic
934635481 2:95984253-95984275 AGGAAGTGAAGTACCTAGGTAGG + Intronic
934798150 2:97120999-97121021 AGGAAGTGAAGTACCTAGGTAGG - Intronic
934835274 2:97582439-97582461 AGGAAGTGAAGTACCTAGGTAGG + Intronic
936639082 2:114292390-114292412 TGTAGATGAAATACATAGGGTGG - Intergenic
936853772 2:116932993-116933015 TGGGGGTGAAATCCCTAGGTTGG + Intergenic
941560706 2:167040760-167040782 TGCAGGTGAAAGAGCTATGGTGG - Intronic
941919381 2:170834062-170834084 TGCAGGCTAAGTACCTAAGTGGG - Intronic
1174587742 20:51621956-51621978 AGCATGTGAATTACCTAGGGTGG - Intronic
1175665633 20:60857436-60857458 TGCAGGTGACAGGCCTAGATTGG + Intergenic
1178632000 21:34269665-34269687 TGCAGGAGAAATATCAAGTTTGG + Intergenic
1179229672 21:39490057-39490079 TGCAGGTGAACTATCTTGATGGG + Intronic
1180085248 21:45505334-45505356 TGCAGGAGAGAAACCAAGGTGGG - Intronic
1181712629 22:24700198-24700220 GGCAGGTGAATTAACTAGGGAGG + Intergenic
950532882 3:13563265-13563287 TCCAGGTGAGAGACCTGGGTGGG - Intronic
952606984 3:35159777-35159799 TGAATATGATATACCTAGGTAGG - Intergenic
954579564 3:51695930-51695952 TGCATGTGGAAGACCCAGGTGGG + Intronic
955285303 3:57634752-57634774 TTCAGGTGAAATTCCTAAGCAGG - Exonic
956259595 3:67324203-67324225 TGCATGTGAAATACCGATGATGG + Intergenic
958084478 3:88789084-88789106 TGTAAATGAAATAGCTAGGTTGG - Intergenic
963621585 3:147614147-147614169 TGCATGTCAAAAACATAGGTAGG + Intergenic
965064801 3:163832762-163832784 GGCATTTGAAAAACCTAGGTGGG - Intergenic
966559844 3:181308084-181308106 TGCAGTAGAAATAGCTAAGTAGG + Intergenic
968769154 4:2492782-2492804 TGCAGGTGAAGCACCAAGGTGGG - Intronic
970842447 4:20490196-20490218 TATATGTGAAATACTTAGGTTGG - Intronic
970965757 4:21925887-21925909 TGGAGCTGGAAGACCTAGGTTGG + Intronic
972797113 4:42432495-42432517 GGCTGGTGAAATACCATGGTGGG + Intronic
977035490 4:91946418-91946440 TGCATGTGAAATACATATTTTGG + Intergenic
981175994 4:141684049-141684071 TGCAGGTGAAAGACCCTGTTGGG + Intronic
987166293 5:15201897-15201919 GGAAGGTGAAATGCCTAGGGAGG + Intergenic
991617446 5:68511691-68511713 TTCAGGTGAAAGACAGAGGTAGG + Intergenic
994504240 5:100620307-100620329 TGCAGCTGAAATCCCTACCTGGG - Intergenic
994886287 5:105565869-105565891 TACATATGAAATACCTAGCTAGG - Intergenic
1001763333 5:174225320-174225342 TACAGGTCAAATCCCTAGGCAGG + Intronic
1003767142 6:9251097-9251119 TGCAGCTGAAACATCTAGGCGGG + Intergenic
1004485227 6:16060217-16060239 TGCAGGTGAGACAGCCAGGTGGG + Intergenic
1007150649 6:39687561-39687583 TGCAGATGAAAGGGCTAGGTGGG + Intronic
1008288074 6:49678775-49678797 TTCAGGTGAAAGACCTTTGTAGG - Intergenic
1009936726 6:70242794-70242816 TGAAGGAAAAAAACCTAGGTAGG - Intronic
1011715449 6:90100295-90100317 TGGAAGTGAAATCGCTAGGTAGG + Intronic
1012856613 6:104509101-104509123 TGCAGCTGAACTTCCCAGGTGGG - Intergenic
1015316875 6:131826897-131826919 TTCAGGTGAAATACCCAGCATGG + Intronic
1016502992 6:144743657-144743679 TGCAGGTGAAAAACCAAAGCTGG - Intronic
1023567353 7:41536768-41536790 TGCTGGTGAGATACTCAGGTGGG + Intergenic
1025867720 7:65402113-65402135 GGCAGGCGAATCACCTAGGTCGG - Intergenic
1030065199 7:105653949-105653971 TGCAGCAGAAACACCTAGGAAGG - Intronic
1031241842 7:119254869-119254891 AACATGTGAAATATCTAGGTAGG + Intergenic
1031244546 7:119292507-119292529 TGGAGGTTAAAAACTTAGGTAGG + Intergenic
1033091168 7:138387474-138387496 TGCTTGTGCAATAGCTAGGTTGG - Intergenic
1033581887 7:142745637-142745659 TGCAGGAGAAACACCCATGTAGG - Intergenic
1037715125 8:21391202-21391224 AGGAGGGGAAATACCTAGGCAGG - Intergenic
1038484276 8:27922453-27922475 TGCAGGTGAGACACCTAGCCAGG - Intronic
1044316099 8:90751375-90751397 TGCAGGTGAAATATTCAGGTGGG + Intronic
1046663297 8:116972508-116972530 TGAAGGTGAAAAACCTACATCGG - Intronic
1048145406 8:131836971-131836993 TGCAGGTTTATTACATAGGTAGG + Intergenic
1050648855 9:7753400-7753422 TGCAGGTGAATTACCTCTGTAGG + Intergenic
1053345782 9:37377317-37377339 AGAAGGTAAAATACATAGGTAGG + Intergenic
1059170088 9:112116672-112116694 TGCAGGTGAGATATGCAGGTAGG + Intronic
1060044704 9:120330611-120330633 TGCATGTGAAACACCGAGGATGG - Intergenic
1189294683 X:39910099-39910121 TCCAGGGGAATTACCGAGGTGGG + Intergenic
1189453055 X:41157444-41157466 TGCAGGGGCAACTCCTAGGTAGG + Intronic
1190379828 X:49829056-49829078 TGCAGGTGAAATGCAGAGCTGGG + Intergenic
1194871087 X:99132256-99132278 TAGAGGTGAACTACCTGGGTGGG - Intergenic
1195229558 X:102832188-102832210 GGCAGGAGAGATAACTAGGTGGG + Intergenic
1196109599 X:111931881-111931903 TGCATGTTATATACCTAGGATGG + Intronic
1198090987 X:133329692-133329714 TGCAAATGAAATACATGGGTGGG - Intronic
1198922679 X:141747763-141747785 TGCAGGTCTATTACATAGGTAGG - Intergenic