ID: 1155382137

View in Genome Browser
Species Human (GRCh38)
Location 18:25235459-25235481
Sequence ACTTCATTTCACCACGTTAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 127}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155382137 Original CRISPR ACTTCATTTCACCACGTTAA TGG Intronic
904444383 1:30556124-30556146 ACTACAATTCATCACTTTAAAGG + Intergenic
906942773 1:50270954-50270976 AGTTCATTTCAACAGGCTAAGGG - Intergenic
908943095 1:69460356-69460378 ACTTCTCTTCAGCACTTTAATGG + Intergenic
909133083 1:71764084-71764106 ACTTCATGTCACCACTTGTATGG - Intronic
909707426 1:78603926-78603948 ACTTCATTTCTTGACGTTCAAGG + Intergenic
910944981 1:92581061-92581083 ATTTCTTTTCACCATGTTCATGG + Intronic
921698116 1:218235588-218235610 ATTTCTTTTCACAAGGTTAAAGG + Intergenic
924908027 1:248477799-248477821 AGTTTATTTCACCAAGGTAAAGG - Intergenic
924916081 1:248570284-248570306 AGTTTATTTCACCAAGGTAAAGG + Intergenic
1063726885 10:8646977-8646999 ACTTAATCTAGCCACGTTAATGG + Intergenic
1064742700 10:18449745-18449767 ACTTCCCTTAACCATGTTAAAGG + Intronic
1068302945 10:55169437-55169459 ACTACATTTCAACCCTTTAAAGG + Intronic
1068756042 10:60654332-60654354 ACTTCTTTTCAACACGGTACTGG - Intronic
1068869253 10:61926059-61926081 AAATCATTTCATCATGTTAAGGG + Intronic
1069077841 10:64056796-64056818 ACATCATTCCACCACTTAAAGGG + Intergenic
1069270646 10:66522940-66522962 ACTTCCTGTCACCACATTATTGG + Intronic
1073620063 10:105037364-105037386 ACTTCAAGTCACCAAGTTCATGG - Intronic
1083562892 11:63687678-63687700 ATTTCATTTCTTCACATTAATGG - Intronic
1087698616 11:101410819-101410841 CCTTCTTTTCATCACGTTGATGG - Intergenic
1093869554 12:24271725-24271747 AATTTATTTCTCCACTTTAAAGG + Intergenic
1097098607 12:56570194-56570216 TCTTCCTTTCACCAAGTTATTGG + Intronic
1097715458 12:62961321-62961343 ACTTCATGTCAGCACTTTAAAGG - Intergenic
1101313358 12:103605697-103605719 AGTTCATTTCATAATGTTAATGG - Intronic
1102389358 12:112537022-112537044 ACTTCATATCCCCACTTTTAGGG + Intergenic
1103967350 12:124648136-124648158 CCTTCATTTCATCACCTCAATGG + Intergenic
1105656264 13:22442764-22442786 ACTTCTATTCACCATGTTATAGG - Intergenic
1106976634 13:35225497-35225519 CCTTCATTGCTCCAGGTTAAAGG - Intronic
1109674549 13:65657919-65657941 ACCTCATTTAACCTCCTTAAAGG + Intergenic
1110453100 13:75659316-75659338 ACTGTATTTCACCACATTAATGG - Intronic
1112548281 13:100393298-100393320 ACTTTCTTTTACCACTTTAAAGG + Intronic
1114156839 14:20113389-20113411 ACTTCATGACACCAAATTAAGGG - Intergenic
1115173897 14:30540057-30540079 ACTTCATTTAATAACGTAAAAGG - Intergenic
1118027476 14:61784198-61784220 ACTTCCTTTCACAATGCTAAAGG + Intronic
1118087405 14:62433538-62433560 GGTTCATTTCACCACTATAAAGG - Intergenic
1118648268 14:67861731-67861753 ACTTCATTTCTTCAAGGTAAAGG + Intronic
1118919571 14:70137859-70137881 ACTTCAATTCACCTCCTTAGGGG + Intronic
1126975227 15:54170610-54170632 ATTTCATTTGAACAGGTTAAAGG + Intronic
1131615746 15:94015483-94015505 GCTTCATTTCACAACATGAATGG + Intergenic
1133773753 16:8882735-8882757 ACTTCCTTGCAACACTTTAAGGG - Intergenic
1138846081 16:60568097-60568119 ACTTCATTTCAACATGGTACTGG + Intergenic
1139069406 16:63361826-63361848 CCTTCATTTAACCACCTAAAGGG + Intergenic
1140636564 16:76921706-76921728 ACATGATATCAACACGTTAATGG - Intergenic
1141958479 16:87388729-87388751 ACATCATTTCCCCACGGTTATGG + Intronic
1142994617 17:3753330-3753352 GCTCCATTTTACCACGTTCATGG - Exonic
1146930435 17:36773535-36773557 ACTTCATATCACAATGGTAATGG + Intergenic
1154012077 18:10582821-10582843 GCTTCCTTTCACCAGGTGAATGG + Intergenic
1155382137 18:25235459-25235481 ACTTCATTTCACCACGTTAATGG + Intronic
1157411814 18:47469473-47469495 AGTCCATTTCACCCCCTTAATGG + Intergenic
1159572211 18:70129207-70129229 AGATTATTTCACCATGTTAAAGG - Intronic
1164286081 19:23819002-23819024 ATTCCCTTTAACCACGTTAAAGG - Intronic
1164853715 19:31504510-31504532 ACTTCAACTCACCAGGTAAATGG + Intergenic
927987122 2:27419801-27419823 ACTTTATATCACCAAGTTTATGG - Intergenic
930989529 2:57635649-57635671 ACTTTATTTCAGCACTTTAAAGG + Intergenic
931324954 2:61211254-61211276 ACTTTATTTCTCTAGGTTAAGGG + Intronic
932261867 2:70333622-70333644 ACTTCATTTCATTAAGGTAAAGG - Intergenic
933231433 2:79812260-79812282 ACTTCTATTCACCATGATAATGG - Intronic
934920553 2:98341461-98341483 AATTCATTTCACCAGGATCATGG + Intronic
934962342 2:98687723-98687745 ACTTTATTTCTCCATGTGAATGG + Intronic
935838660 2:107083463-107083485 ACTTCATTTCATAACTTTTAAGG + Intergenic
937899465 2:127006763-127006785 ATTTCATTTCAGCACAGTAATGG + Intergenic
940544454 2:155065638-155065660 ACTTCTATTCACCATGTTACTGG - Intergenic
944446649 2:199798613-199798635 TCTTCATTCCACCACGTGAGCGG + Intronic
945450564 2:209990425-209990447 ACTTCTTTTCTCTACCTTAATGG + Intronic
947383858 2:229571126-229571148 ACCTCATTTCTCCACCTTCACGG - Intronic
1169896157 20:10507360-10507382 ACCTCATCTCCCCACTTTAAAGG - Intronic
1172822784 20:37752929-37752951 ATTTCATTTCACAAGGTAAAAGG - Intronic
1173408376 20:42787272-42787294 TCTTAATTTCACCAGGATAATGG + Intronic
1174684554 20:52441208-52441230 ACTTCATGTCACTATTTTAAGGG - Intergenic
1175590560 20:60187738-60187760 AGTTCCTTTAACCACTTTAAAGG + Intergenic
1180670296 22:17547957-17547979 ACTTCCTTTCACCCCTTTCACGG - Intronic
1182663781 22:31943461-31943483 ACTTGATTTCAACACGCCAAGGG - Intronic
949352975 3:3144595-3144617 ACTTTATTTGACTACTTTAATGG + Exonic
951598968 3:24351414-24351436 ACTTCGTTGCAACACATTAATGG - Intronic
951644512 3:24873313-24873335 ACTTCATTTAACTTCGTTAATGG + Intergenic
953241841 3:41156308-41156330 ACTTCAATTCACCAATTTTAGGG + Intergenic
956889686 3:73600005-73600027 ATTTCATTTCACCACAGTATTGG + Intronic
964397568 3:156262226-156262248 ACTTCTTTTCAACACTGTAAAGG - Intronic
965053353 3:163680958-163680980 ATTTTATTTCACCTCCTTAAGGG - Intergenic
965147005 3:164918443-164918465 ACTTCACTTCACCACTTGGATGG + Intergenic
967081330 3:186052452-186052474 ACTTAATGGCAACACGTTAATGG - Intronic
968684568 4:1948888-1948910 AGTTTGTTCCACCACGTTAAGGG + Intronic
970734148 4:19146330-19146352 ACATCATTTCACCAGGTTCGAGG - Intergenic
971673739 4:29596663-29596685 AATCCATTTCTCCAGGTTAAGGG + Intergenic
974285659 4:59864313-59864335 ACTTGAGTTCACCACGGTACTGG + Intergenic
975514570 4:75232327-75232349 TTTTCATTTCACCAGGGTAAAGG + Intergenic
975712648 4:77175689-77175711 ATCTGTTTTCACCACGTTAACGG + Intronic
977894585 4:102349072-102349094 ACTTCACTTCCCCAAGTGAAAGG + Intronic
978594543 4:110362579-110362601 ACTTCATTTCATCATCTTCAAGG - Intergenic
980351439 4:131690455-131690477 ACTTCCTTTCATCACACTAAAGG + Intergenic
980590320 4:134878944-134878966 AATTCTTTTCACCATGATAAAGG - Intergenic
986602599 5:9488073-9488095 TCATCATTTCACCACCTTTAAGG + Intronic
987451057 5:18084561-18084583 ACTCCATGTCACCAAGTAAATGG - Intergenic
992547668 5:77830682-77830704 AATTAATTTCAGCATGTTAAAGG + Intronic
994879326 5:105467293-105467315 ACTTCATTTCTCCAAGGAAAAGG + Intergenic
1005719642 6:28588693-28588715 ACTACAATTCACCAAGTTACTGG + Intronic
1008142531 6:47848156-47848178 GCTTCATGTCTCCACCTTAAGGG + Intergenic
1009310931 6:62151658-62151680 ACTTCAGTTCACCACCTAACAGG - Intronic
1009584625 6:65582990-65583012 ATTTCATTTCATCACAGTAATGG + Intronic
1011844645 6:91548373-91548395 TCTCCATTTGACCACGTGAATGG - Intergenic
1013029970 6:106323679-106323701 ACTGCATTTATCCAGGTTAAAGG - Intronic
1013557471 6:111271068-111271090 ACTGCATTTCAGTAGGTTAAAGG - Exonic
1013847752 6:114474876-114474898 AATTCATTTACCCACCTTAATGG - Intergenic
1013858020 6:114598191-114598213 ACTTCAGTTGACCACTGTAAGGG + Intergenic
1015568990 6:134602631-134602653 CCTTGATTTTACCATGTTAAGGG - Intergenic
1015804314 6:137092899-137092921 ACAGCATTTCACCATGTTAGTGG + Intergenic
1015902923 6:138085872-138085894 AATTCATTTCAGCATATTAATGG + Intergenic
1016181506 6:141153312-141153334 TCTTTATTTCACCACATCAATGG + Intergenic
1016591158 6:145745186-145745208 AATTGATTTCACCAGATTAATGG + Intergenic
1018410086 6:163536102-163536124 AATTAATTTCATCAAGTTAATGG - Intronic
1018669200 6:166166084-166166106 ACTTTATTCCACCAGGTGAAAGG - Intronic
1020503555 7:8954403-8954425 ACATCATTTCATCACTTTAAAGG + Intergenic
1024555296 7:50598604-50598626 TCTTCATTTCACAATGATAAGGG + Intronic
1032389421 7:131546362-131546384 ACTGCATTTAACCACGTTATGGG + Intronic
1032695578 7:134333372-134333394 CCTTCTTTTCACCACGTTTTTGG - Intergenic
1038587893 8:28807590-28807612 ACTGCAGTTCACTACATTAATGG + Intronic
1039159916 8:34606222-34606244 ACTTCAGTTGACCTCATTAAAGG + Intergenic
1043020907 8:74998496-74998518 ACGGCATTTCACCATGTTGAAGG - Intronic
1045955490 8:107900936-107900958 GCTTCCTTTCACCATGTTACTGG + Exonic
1046700005 8:117389549-117389571 ACTACACTTCACCACACTAAAGG + Intergenic
1049163736 8:141113804-141113826 ACTGCCTTTCTCTACGTTAAAGG - Intergenic
1050044754 9:1531313-1531335 ACTTCATTTCTTCCCTTTAAGGG - Intergenic
1050094507 9:2049750-2049772 ACTTCATTTAACCCTTTTAAGGG - Intronic
1050562300 9:6846685-6846707 ACTGAATTTCTCCCCGTTAATGG - Intronic
1051253839 9:15191507-15191529 ACTTCATCACACCACATCAAAGG - Intronic
1185798968 X:2992151-2992173 ATTACATTTCTCCACGTTAAAGG + Intergenic
1187203616 X:17160021-17160043 ACTTCACTTCTCAAGGTTAAAGG - Intergenic
1187356061 X:18573106-18573128 ACTTCATTTTTCCACCTTAATGG - Intronic
1192635376 X:72811028-72811050 ACTATATTTCACCATATTAATGG - Intronic
1192646338 X:72909775-72909797 ACTATATTTCACCATATTAATGG + Intronic
1192753295 X:74017880-74017902 ACTTTAGTTCACCATGTTACTGG + Intergenic
1198318316 X:135492548-135492570 AATTCAGTTCACCATATTAATGG + Intergenic
1199570370 X:149261457-149261479 ACCTCATTTTACCTCTTTAAAGG + Intergenic
1200821199 Y:7584369-7584391 ACCTCAATTCATCACGTTGAGGG - Intergenic
1202239103 Y:22748373-22748395 ACCTCAATTCATCACGTTGAGGG + Intergenic
1202392091 Y:24382140-24382162 ACCTCAATTCATCACGTTGAGGG + Intergenic
1202478693 Y:25287977-25287999 ACCTCAATTCATCACGTTGAGGG - Intergenic