ID: 1155384999

View in Genome Browser
Species Human (GRCh38)
Location 18:25267431-25267453
Sequence GGGTCAGACTGCCTCCTCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 273
Summary {0: 1, 1: 8, 2: 25, 3: 50, 4: 189}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155384994_1155384999 4 Left 1155384994 18:25267404-25267426 CCCAGCACAGCATTCGAGCTCTG 0: 33
1: 197
2: 444
3: 755
4: 1115
Right 1155384999 18:25267431-25267453 GGGTCAGACTGCCTCCTCAAGGG 0: 1
1: 8
2: 25
3: 50
4: 189
1155384995_1155384999 3 Left 1155384995 18:25267405-25267427 CCAGCACAGCATTCGAGCTCTGA 0: 15
1: 93
2: 244
3: 596
4: 1034
Right 1155384999 18:25267431-25267453 GGGTCAGACTGCCTCCTCAAGGG 0: 1
1: 8
2: 25
3: 50
4: 189

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155384999 Original CRISPR GGGTCAGACTGCCTCCTCAA GGG Intronic
901678051 1:10898321-10898343 GGGTCAGAGGGCCCCCTCAAGGG + Intergenic
903494836 1:23758757-23758779 AGGCCAGCCTGCCTCCTGAATGG - Intronic
906878761 1:49566751-49566773 TGGGCAGACTGCCTCCTCAAGGG - Intronic
907876098 1:58489697-58489719 GGGGCAGACTGACACCTCACAGG + Intronic
909422006 1:75477009-75477031 GGGGCAGACTGACACCTCACAGG + Intronic
910200281 1:84691230-84691252 GGGTCAGGCTGTCTCCTCCCTGG + Intergenic
910626984 1:89317291-89317313 GGGACAGACTGCCTCCTTACTGG + Intergenic
911867818 1:103050987-103051009 GGGGCAGACTGACACCTCACAGG - Intronic
912794462 1:112683473-112683495 GTGGCAGACTGCAGCCTCAAGGG + Intronic
912960015 1:114188014-114188036 GGGGCAGACTGACACCTCACAGG - Intergenic
913098907 1:115545292-115545314 GGGGCAAGCAGCCTCCTCAATGG - Intergenic
913299672 1:117357950-117357972 GGGGCAGACTGACACCTCACAGG - Intergenic
913710470 1:121477797-121477819 TGGACAGACTGCCTCCTCAATGG + Intergenic
913720320 1:121586606-121586628 GGGACAGACTGCCTCCTGATTGG - Intergenic
914339078 1:146742973-146742995 GGGTCAGAATGACTGCTCAAAGG - Intergenic
914381401 1:147119647-147119669 GGGTCAAAATGTCTCTTCAATGG - Intergenic
915814693 1:158953409-158953431 CGGGCAGACTGCCTCCTCAAGGG + Intronic
915869129 1:159538956-159538978 GGGGCAAACTGCCACCTCACAGG + Intergenic
918351346 1:183658816-183658838 GGGGCAGACTGACACCTCACAGG + Intronic
918583740 1:186162799-186162821 GGGGCAGACTGACACCTCACAGG - Intronic
918689795 1:187466200-187466222 GGGACAGACTCCCTCCCCAGGGG + Intergenic
922197409 1:223371927-223371949 GGGGCAGACTGACACCTCACTGG - Intergenic
1065446780 10:25810439-25810461 AGGCAAGACTCCCTCCTCAAAGG - Intergenic
1065463637 10:25995889-25995911 GGGGCAGACTGACACCTCACAGG - Intronic
1068651645 10:59528871-59528893 TGAACAGCCTGCCTCCTCAAGGG + Intergenic
1069325954 10:67231408-67231430 GGGGCAGACTGACACCTCACAGG + Intronic
1070559506 10:77555216-77555238 GAGTCAGACGGCCCCCTCACAGG + Intronic
1070796546 10:79220177-79220199 GGGTCCCACTGCATCCTCACAGG - Intronic
1070990449 10:80727855-80727877 CGGGCAGACTGCCTCCTCAAGGG - Intergenic
1071459371 10:85877358-85877380 GGGGCAGACTGACACCTCACAGG + Intronic
1071745224 10:88411013-88411035 GGCTCAGAGTTCCTTCTCAAAGG + Intronic
1072397872 10:95064015-95064037 GGGGCAGACTGACACCTCACAGG - Intronic
1075451853 10:122557248-122557270 GGGTCAGACTGACACCTGAAGGG + Intergenic
1076741502 10:132488069-132488091 GGGGCAGAGTGAGTCCTCAATGG - Intergenic
1078304879 11:10173894-10173916 GGGGCAGACTGACACCTCACAGG + Intronic
1079342509 11:19624221-19624243 CGGACAGACTGCCTCCTCAGTGG - Intronic
1079454799 11:20626909-20626931 GGGTTAGACTTCCTCCTCCAGGG + Intronic
1079842871 11:25425879-25425901 GGGGCAGACTGACACCTCACAGG + Intergenic
1079848609 11:25501370-25501392 GGGGCAGACTGACACCTCACAGG - Intergenic
1079909590 11:26292888-26292910 CGGACAGACTGCCTCCTCGTGGG - Intergenic
1080346815 11:31334865-31334887 TGGACAGACTGCCTCCTCAGTGG - Intronic
1081592981 11:44437974-44437996 GGGACAGACTGCCTCCTAAGTGG + Intergenic
1081697686 11:45127739-45127761 GGGGCAGACTGACACCTCACAGG - Intronic
1082202372 11:49388076-49388098 AGGTAAGATTGACTCCTCAATGG - Intergenic
1082596221 11:55085117-55085139 GGGGCAGACTGACACCTCACAGG + Intergenic
1084311914 11:68321967-68321989 GGAGCAGACTGTCTCCTCTAGGG + Intronic
1088508934 11:110554586-110554608 GGGGCAGACTGACACCTCACAGG + Intergenic
1089789554 11:120932836-120932858 GGGGCAGCTGGCCTCCTCAAGGG + Intronic
1091062811 11:132479758-132479780 GGGGCAGACTGACACCTCACAGG + Intronic
1091224555 11:133949816-133949838 GGGCCAGGCTCCCCCCTCAAAGG + Intronic
1091358373 11:134955558-134955580 GGTGCACACTGCCTGCTCAATGG - Intergenic
1091810904 12:3397469-3397491 GGGGCAGACTGACACCTCACAGG - Intronic
1093320207 12:17704838-17704860 TGGGCAGACTGCCTACTCACGGG - Intergenic
1093480779 12:19601808-19601830 GGGCCAGACTGCTGCCTCAATGG + Intronic
1095073868 12:37893075-37893097 TGGGCAGACTGCCTCTTCAAAGG + Intergenic
1095340787 12:41086716-41086738 GGGGCAGACTGACACCTCACAGG - Intergenic
1096532884 12:52253074-52253096 AGGACAGACAGCCTCCTCCATGG - Intronic
1096941910 12:55355882-55355904 GGGTCAGATTGCCTCCTCAAGGG + Intergenic
1097304945 12:58058928-58058950 GGGGCAGACTGACACCTCACAGG - Intergenic
1097528332 12:60766716-60766738 GGGGCAGACTGACACCTCACAGG - Intergenic
1098015493 12:66100184-66100206 AGGACAGACTGCCTCCTCAAGGG - Intergenic
1104891776 12:132143746-132143768 GGGTCCGGCCGCCTCCTCCAGGG + Exonic
1105244001 13:18631527-18631549 TGGACAGACTGCCTCCTTAAGGG + Intergenic
1106377383 13:29202994-29203016 GGGACAGACTGCTTCCTCAGGGG - Intronic
1106388077 13:29307570-29307592 GTGTCAGAGGGCCCCCTCAAGGG + Intronic
1106445710 13:29829061-29829083 GGGGCAGACTGACACCTCACAGG - Intronic
1106607019 13:31237777-31237799 GGAGCAGGCTGGCTCCTCAAAGG + Intronic
1107227280 13:38066122-38066144 GGGGCAGACTGACACCTCACAGG + Intergenic
1108988806 13:56629350-56629372 CGGACAGACCACCTCCTCAAGGG + Intergenic
1109270552 13:60251282-60251304 GGGGCAGACTGACGCCTCACAGG - Intergenic
1109719513 13:66259022-66259044 GGGGCAGACTGACACCTCACAGG - Intergenic
1111273498 13:85917239-85917261 TCGGCAGACTGCCTCCTCAAGGG - Intergenic
1112620093 13:101046434-101046456 GAGACAGACTGTCTCCTTAAGGG - Intergenic
1115078013 14:29414487-29414509 GGGGCAGACTGACGCCTCACAGG + Intergenic
1115276999 14:31620768-31620790 GGTGCAGACTGCCTACTCAAGGG - Intronic
1115719796 14:36147996-36148018 TGGGCAGACTGCCTCCTCAAGGG - Intergenic
1116773065 14:49149441-49149463 TGGGCAGACTGCCTCCTCAATGG - Intergenic
1117597955 14:57343348-57343370 GGGGCAGACTGACACCTCACAGG - Intergenic
1117710756 14:58526212-58526234 GGGACAGACTGCCTCCTCAAGGG + Intronic
1119084840 14:71730256-71730278 GTGTAAGAAGGCCTCCTCAACGG - Exonic
1120201342 14:81541015-81541037 GGGGAAAACTGCCTACTCAAGGG - Intergenic
1120709703 14:87780838-87780860 GGGGCAGACTGACACCTCACAGG - Intergenic
1121273416 14:92652278-92652300 AGCTCAGCCTGCCTCCCCAAGGG + Exonic
1129940310 15:79491047-79491069 GGGGCAGACTGACACCTCACAGG - Intergenic
1130651107 15:85762649-85762671 GGCTCAGCCTGCCCCATCAAGGG + Intronic
1132416961 15:101627194-101627216 GGGGCAGACTGACACCTCACAGG + Intronic
1133698514 16:8287650-8287672 GGGCCAAACTGCCTCATCACGGG - Intergenic
1134286057 16:12862928-12862950 GGGTCAGGCTGCCCCCTCACAGG - Intergenic
1136991961 16:35158130-35158152 GGGGCAGACTGACACCTCACAGG + Intergenic
1138556872 16:57775929-57775951 GCGTCACCCTGCCTGCTCAAGGG + Intronic
1139995200 16:70974379-70974401 GGGTCAGAATGACTGCTCAGAGG + Intronic
1140197636 16:72868485-72868507 GGGTAAGACTGGCTCCCCAGTGG - Intronic
1140454343 16:75096014-75096036 GGGGCAGGCCACCTCCTCAAGGG + Intronic
1144632341 17:16880648-16880670 GGGTCAGAGCCCCTCCTCCAGGG - Intergenic
1145804524 17:27717053-27717075 GGGTAAGACTGCCACCTCCTTGG - Intergenic
1146298490 17:31670377-31670399 CAGACAGACTGCCTCCTCAAGGG - Intergenic
1146479907 17:33196912-33196934 GGGACAGACAGCTTCCTCCATGG - Intronic
1147141269 17:38461784-38461806 GAGTCAGACGCCCTCCTCACAGG - Intronic
1148999986 17:51747652-51747674 GGGTCGGAGCACCTCCTCAATGG - Exonic
1150818289 17:68413379-68413401 GGGGCAGACTGACACCTCACAGG - Intronic
1150875297 17:68963529-68963551 GGGTCATCCTGCCTCATGAATGG - Intergenic
1152032286 17:77851435-77851457 GGGTTAAACTGCCTCATAAAAGG + Intergenic
1153726069 18:7956605-7956627 GGACCAGACTGCCTGCACAAAGG - Intronic
1154444941 18:14428374-14428396 TGGACAGACTGCCTCCTTAAGGG - Intergenic
1155114281 18:22749270-22749292 GGGTCAAGCTGCCTCCTCAGTGG + Intergenic
1155384999 18:25267431-25267453 GGGTCAGACTGCCTCCTCAAGGG + Intronic
1155986157 18:32233177-32233199 GGGGCAGACTGACACCTCACAGG - Intronic
1157336497 18:46742743-46742765 CAGACAGACTGCCTCCTCAAGGG + Intronic
1157701917 18:49766723-49766745 TGGGCAGACTGCCTCCTCCCAGG + Intergenic
1158655705 18:59330639-59330661 AGGTCAGACTTCCTAATCAAAGG - Exonic
1159376924 18:67604377-67604399 GGGGCAGACTGACACCTCACAGG + Intergenic
1160505974 18:79427072-79427094 GGGACATGCTCCCTCCTCAATGG - Intronic
1165809706 19:38605122-38605144 GCCTCAGCCTGCCTCCTCAAAGG + Intronic
1166544962 19:43628615-43628637 GGGACAAAGTGCCTTCTCAATGG - Intronic
1166672879 19:44722200-44722222 GGGTGAGGCTCCCTCCTCATTGG - Intergenic
928052450 2:28013375-28013397 GGGTGAGGCTGCCTACTGAATGG + Intronic
929966260 2:46539500-46539522 GGGTCAGATTTCTTCCTCAGTGG + Intronic
930216954 2:48707380-48707402 CAGACAGACTGCCTCCTCAAGGG - Intronic
931713536 2:65010274-65010296 GGGTTGGACAGCCACCTCAAAGG - Intronic
932105121 2:68935332-68935354 GGGTGAGACTGTCTCCCAAATGG - Intergenic
932980054 2:76653254-76653276 GGGGCAGACTGACACCTCACAGG - Intergenic
935331380 2:101980142-101980164 GGGTCAGTCTGCTTCCTTAGGGG + Intergenic
940400765 2:153245292-153245314 GGGACAGACTGCCTCCTCAATGG + Intergenic
940401838 2:153256785-153256807 CAGGCAGACTGCCTCCTCAAGGG - Intergenic
941121562 2:161536404-161536426 GGGGCAGACTGACACCTCACAGG + Intronic
942731601 2:179066631-179066653 CGGGCAGACTGCTTCCTCAGTGG - Intergenic
945628195 2:212237564-212237586 GCGACAGACTGCCTCCTCAGTGG - Intronic
947146002 2:227065612-227065634 GGGGCAGACTGACACCTCACAGG + Intronic
948820935 2:240545243-240545265 GGGGCAGACTGACACCTCACAGG + Intronic
1170169317 20:13393465-13393487 GTGTCAGAGGGCCCCCTCAAGGG + Intronic
1170569496 20:17624940-17624962 GGGCCAGCCTGTGTCCTCAAAGG + Intronic
1172665756 20:36598576-36598598 GGGTAAGACTGGCCCCTCACAGG - Intronic
1174166598 20:48587861-48587883 GGGGCAGACTGACACCTCACAGG + Intergenic
1176451044 21:6861498-6861520 TGGACAGACTGCCTCCTTAAGGG + Intergenic
1176829213 21:13726549-13726571 TGGACAGACTGCCTCCTTAAGGG + Intergenic
1176915596 21:14621811-14621833 TGGACAGACTGCCCCCTCAAGGG + Intronic
1177541051 21:22494151-22494173 GGGACAGACTGTCTCCTTAAGGG + Intergenic
1177694631 21:24555490-24555512 GGGACAGACTGCCTCCTCAAGGG + Intergenic
1178683124 21:34689947-34689969 GAGTCAGAATGGCTCCTAAAAGG - Intronic
1178794913 21:35735025-35735047 TAGTCTGACTCCCTCCTCAAGGG - Intronic
1179292116 21:40028121-40028143 GGGGCAGACTGACACCTCACAGG - Intronic
1179292922 21:40033911-40033933 GGGGCAGACTGACACCTCACAGG + Intronic
1182194884 22:28506031-28506053 TGGCCAGACTGCTTCCTTAAGGG + Intronic
1183530448 22:38350667-38350689 AGGACAGGCTGCCTCCTCCAAGG + Intronic
1184309394 22:43631466-43631488 GGCTCAGGCTGCCTCATCTATGG + Intronic
949594531 3:5530462-5530484 GTGACAGACTACCTCCTCAAGGG - Intergenic
949646390 3:6100075-6100097 GGTTAACTCTGCCTCCTCAAGGG + Intergenic
950359337 3:12439407-12439429 GGCCCAGAATGCCTCCTTAAAGG - Intergenic
950508157 3:13408973-13408995 TGGCCAGGCTGCCTCCTCAAAGG + Intronic
950523316 3:13509086-13509108 GGGTGAGCAGGCCTCCTCAAAGG - Intergenic
951286554 3:20820785-20820807 GGGGCAGACTGACACCTCACAGG - Intergenic
951687540 3:25361966-25361988 GGGACAGACTGCCTCCTCAGTGG - Intronic
953305509 3:41824919-41824941 GGGGCAGACTGACACCTCACAGG + Intronic
954748229 3:52799017-52799039 TGTACAGACTCCCTCCTCAATGG + Exonic
957324570 3:78675931-78675953 GGGGCAGACTGACACCTCACAGG + Intronic
957948787 3:87097698-87097720 CAGACAGACTGCCTCCTCAAGGG - Intergenic
958176000 3:89996714-89996736 GGGGCAGACTGACACCTCACAGG + Intergenic
959835742 3:110916696-110916718 GGGGCAGACTGACACCTCACAGG - Intergenic
963159939 3:142140847-142140869 TGGACAGTCAGCCTCCTCAAGGG - Intronic
964658040 3:159090178-159090200 GGGGCAGACTGACACCTCACAGG - Intronic
967737109 3:192964884-192964906 GGGGCAGACTGACACCTCACAGG - Intergenic
967943414 3:194783743-194783765 GGGGCAAACTGCAGCCTCAAAGG + Intergenic
970985033 4:22147094-22147116 CGGACAGACTGCCTCCTCAAGGG + Intergenic
973332394 4:48923188-48923210 CGGGCAGACTGCCTCCTCAGTGG - Intergenic
973579221 4:52325045-52325067 GGGGCAGACTGACACCTCATAGG - Intergenic
974161773 4:58149982-58150004 CGGCCAGACTGCCTCCTCTCCGG + Intergenic
975390534 4:73811891-73811913 GGGTCAACATGCCTCCTCACAGG - Intergenic
975764745 4:77655394-77655416 GGGACAGACTGCCTCCTCAAGGG + Intergenic
976852831 4:89568073-89568095 GGGACAGACTGTCTCCTCAAAGG - Intergenic
976905238 4:90228356-90228378 GGGGCAGACTGACACCTCACAGG + Intronic
978928982 4:114287689-114287711 TGGACAGACTGCCTCCTGAAGGG + Intergenic
980330329 4:131403071-131403093 GGGACAGACTGCCTCCTCAAGGG - Intergenic
985181480 4:187268951-187268973 GTGTCCAACTGCCTCCTCTATGG + Intergenic
987528180 5:19080377-19080399 CGGCCAGACTGCCTCCTCTCTGG - Intergenic
989675219 5:43965651-43965673 CGGCCAGACTGCCTCCTCTCTGG - Intergenic
989787360 5:45347122-45347144 GGGGCAGACTGACACCTCACAGG + Intronic
991421746 5:66449736-66449758 CAGGCAGACTGTCTCCTCAAGGG - Intergenic
991543711 5:67758223-67758245 CAGACAGACTGCCTCCTCAAGGG + Intergenic
995270697 5:110216963-110216985 TGAACAGACTGCCTCCTCAAGGG - Intergenic
995475099 5:112539607-112539629 GGGACAGCCTTCCTCCTCAAGGG + Intergenic
996002780 5:118383716-118383738 GGGGCAGACTGACACCTCACAGG + Intergenic
996231131 5:121064985-121065007 GGGGCAGACTGACACCTCACAGG + Intergenic
996385650 5:122907380-122907402 GGGGAACACTCCCTCCTCAAGGG + Intronic
997647807 5:135492472-135492494 GGTTCAGCCTGCTTCCTCAAAGG - Intergenic
997885400 5:137625625-137625647 GGGCCTGAGTGCCTCCTCCAGGG - Intronic
998685382 5:144518055-144518077 GGGGCAGACTGACCCCTCACAGG + Intergenic
1002344153 5:178536244-178536266 CGGTCTGCCTGCCTCCTCACGGG + Intronic
1004941347 6:20560299-20560321 GGGTCATACTGCCTCTGAAAGGG - Intronic
1006510411 6:34518283-34518305 GGGCCAGGCTGCCTCCTCTGTGG - Intronic
1006608159 6:35274511-35274533 TGCTTAAACTGCCTCCTCAAAGG - Intronic
1008440501 6:51526971-51526993 GGGTGAGAATGGCTCCTCACTGG + Intergenic
1008801027 6:55368700-55368722 GGGGCAGACTGACACCTCACAGG - Intronic
1008865480 6:56204635-56204657 GGGACAGACTGCCTCCACAGTGG + Intronic
1010670108 6:78676619-78676641 CAGACAGACTGACTCCTCAAGGG + Intergenic
1010679670 6:78783876-78783898 GGGGCAGACTGACACCTCACAGG + Intergenic
1011137351 6:84115060-84115082 GAGACAGACTGCCTCCTTAAGGG - Intergenic
1011245136 6:85314452-85314474 TGGACAGACTGCCTCCTCAAGGG - Intergenic
1011374641 6:86676013-86676035 GGGTAAGACTGCCACCTCCTTGG + Intergenic
1011387623 6:86815121-86815143 GGGACAGACTGCTTCCTCAAGGG - Intergenic
1012598027 6:101062668-101062690 TGGACAGATTACCTCCTCAAGGG + Intergenic
1012923619 6:105245121-105245143 GGGGCAGACTGTCACCTCACAGG + Intergenic
1012969791 6:105716796-105716818 CGGGCAGACTGCCTCCTCAAGGG + Intergenic
1013200697 6:107892247-107892269 CGGCCAGACTGCCTCCTCTCTGG - Intronic
1013883056 6:114928668-114928690 TGGACAGACAGCATCCTCAATGG - Intergenic
1014907154 6:127043903-127043925 TGGACAGACTGCCTCCTCAAGGG + Intergenic
1019203599 6:170340972-170340994 GGGACAGACTGCTTCCTCAATGG - Intronic
1020456873 7:8384018-8384040 GGGTCTGATAGCTTCCTCAAAGG + Intergenic
1021062618 7:16132102-16132124 GGGTAAGACTGCCAGCTCCATGG + Intronic
1021798139 7:24278452-24278474 TGGACAGACTGCCTCCTCAAGGG - Intergenic
1025595093 7:62914240-62914262 GGGGCAGACTGACACCTCACAGG - Intergenic
1026236132 7:68528803-68528825 GGGTCAGACTGCCTGATCATAGG - Intergenic
1027493620 7:78860699-78860721 TGGACAGACTGCCTCCTCAAGGG - Intronic
1028426664 7:90697000-90697022 AGGTCAGCAAGCCTCCTCAATGG - Intronic
1028489406 7:91394739-91394761 GGGGCAGACTGACACCTCACAGG - Intergenic
1028643805 7:93073266-93073288 CAGACAGACTGCCTCCTCAAGGG - Intergenic
1028946398 7:96585301-96585323 CAGGCAGACTGCCTCCTCAATGG - Intronic
1029187847 7:98752403-98752425 GGGTCAAACTGCCTCATCATGGG - Intergenic
1029443528 7:100600921-100600943 GGGCCGGACTCCCTCCTCCAGGG - Exonic
1030140974 7:106303972-106303994 GGGACAGACTGCTTCCTCAAGGG - Intergenic
1032730115 7:134632859-134632881 TGGACAGATTGCCTCCTCAGAGG - Intergenic
1032881814 7:136098928-136098950 GGGGCAGACTGACACCTCACAGG - Intergenic
1032957049 7:136983925-136983947 GGGACAGACTACCTCCTCAAGGG - Intronic
1034960297 7:155360529-155360551 GGCTCAGACTGCCTTCTCCCAGG + Intronic
1035886179 8:3294277-3294299 CAGACAGACTGCCTCCTCAAGGG - Intronic
1037050101 8:14362149-14362171 TGGACAGACTGCCTCCTCAAGGG - Intronic
1037454797 8:19052695-19052717 GGGTCAGATTGTCTACACAAAGG + Intronic
1039639571 8:39205013-39205035 GGGGCAGACTGACACCTCACAGG - Intronic
1039792634 8:40887881-40887903 GGGGCAGATTGGCTCCACAAGGG - Intronic
1040062232 8:43113996-43114018 GGGGCAGACTGACACCTCACGGG - Intronic
1040431700 8:47349432-47349454 CAGACACACTGCCTCCTCAAGGG - Intronic
1041161621 8:55050595-55050617 GGGGCAGACTGACACCTCACAGG + Intergenic
1041949916 8:63489643-63489665 CGGGCAGACTGCCTCCTCAAGGG - Intergenic
1042698309 8:71582358-71582380 GGGGCAGACTGACACCTCACAGG + Intronic
1043232660 8:77822393-77822415 GGGTCAGGGTCCTTCCTCAAGGG + Intergenic
1044183057 8:89218930-89218952 GGGGCAGACTGACACCTCATAGG + Intergenic
1044284772 8:90398766-90398788 GGGGCAGACTGACACCTCACAGG - Intergenic
1044834962 8:96286853-96286875 GTATCAGACTGCCTCATCAAGGG + Intronic
1045433249 8:102133497-102133519 GGGGCAGACTGACACCTCACAGG + Intergenic
1045470255 8:102506052-102506074 GTGTCAGTCTTCCTGCTCAAAGG + Intergenic
1047048097 8:121077752-121077774 GGGCCAGACTGCCAGCTCCAGGG + Intergenic
1047256269 8:123215774-123215796 GCCTCAGACTGCCTCTGCAAGGG + Intergenic
1050074855 9:1852887-1852909 AGCTCAGACTGCCTCTTCAGAGG + Intergenic
1051230521 9:14950374-14950396 GGGACAGACTGCTTCCTCAAGGG + Intergenic
1051321884 9:15914130-15914152 GGGACAGACTGCCTCCTCAAGGG - Intronic
1051550244 9:18319623-18319645 GGGTCAGACCCCCTCCTGGATGG - Intergenic
1052513507 9:29451139-29451161 GGGGCAGACTGACACCTCACAGG + Intergenic
1054856777 9:69909023-69909045 GGGTCATAATGCCTCCACAGTGG - Intergenic
1055807870 9:80116977-80116999 CGGACAGACTGCCTCCTCAGTGG - Intergenic
1056582596 9:87902871-87902893 GGGGCAGACTGACACCTCACAGG + Intergenic
1057701488 9:97366167-97366189 GGGTCTGTCTGCCTCCTTCAGGG + Intronic
1059504095 9:114782120-114782142 GGGTCAGTATGCCTGATCAATGG + Intergenic
1061365178 9:130168955-130168977 AGGTCAGACTCCCGACTCAAGGG - Intergenic
1061699973 9:132408700-132408722 GGGCCAAACTGCCTCATCATGGG + Intergenic
1061859038 9:133458743-133458765 GGGCCAGGCTGCCTCCTCTGGGG - Intronic
1203518137 Un_GL000213v1:23019-23041 TGGACAGACTGCCTCCTTAAGGG - Intergenic
1186866477 X:13725279-13725301 CGGACAGACTGCCTCCTCAAGGG + Intronic
1187839883 X:23476378-23476400 GAGATAGACTGCCTCCTCAAGGG - Intergenic
1190879961 X:54484975-54484997 GGGGCTGCCTGCTTCCTCAAGGG - Intronic
1191656882 X:63607771-63607793 GGGGCAGACTGACACCTCACAGG + Intergenic
1191683520 X:63865790-63865812 GGGGCAGACTGCCTCCTCAAAGG - Intergenic
1191687177 X:63904066-63904088 GGGACAGACTGACACCTCAAAGG - Intergenic
1191982693 X:66943463-66943485 CGGGCAGACTGCCTCCTCAAGGG + Intergenic
1192802493 X:74479938-74479960 TGGACAGACTGCATCCTCAGGGG - Intronic
1193051311 X:77102792-77102814 GGGGCAGACTGACACCTCACAGG - Intergenic
1193059040 X:77185139-77185161 TGGGCAGACTGCCTCCTCAAGGG + Intergenic
1193757551 X:85427095-85427117 GGGGCAGACTGACACCTCACAGG - Intergenic
1194068730 X:89293375-89293397 GGGGCAGACTGACACCTCACAGG + Intergenic
1196249708 X:113446185-113446207 GGGGCAGACTGACACCTCACAGG + Intergenic
1197004060 X:121474582-121474604 GGGCCAGACTGCCTCCTCTCTGG - Intergenic
1197940070 X:131779721-131779743 GCATCAAACTGCCTCCTCAGGGG + Intergenic
1199884647 X:152007510-152007532 GGGGCAGACTGACACCTCACAGG + Intergenic
1200722878 Y:6627530-6627552 GGGGCAGACTGACACCTCACAGG + Intergenic
1201702820 Y:16902520-16902542 GGGGCAGACTGACACCTCACAGG + Intergenic