ID: 1155386055

View in Genome Browser
Species Human (GRCh38)
Location 18:25278622-25278644
Sequence AAAGATAAACAACCTGAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 596
Summary {0: 1, 1: 0, 2: 6, 3: 35, 4: 554}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155386055_1155386056 1 Left 1155386055 18:25278622-25278644 CCTTGCTCAGGTTGTTTATCTTT 0: 1
1: 0
2: 6
3: 35
4: 554
Right 1155386056 18:25278646-25278668 AATACTTTCAAGTCACTTGCTGG 0: 1
1: 0
2: 0
3: 12
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155386055 Original CRISPR AAAGATAAACAACCTGAGCA AGG (reversed) Intronic
901958904 1:12809176-12809198 AAAGATAAACAAAATGAGCCAGG + Intergenic
902464724 1:16608994-16609016 AAGGAAAAATAAGCTGAGCATGG + Intronic
903108733 1:21109259-21109281 AAAAATAAACATCATGAGCAGGG - Intronic
903156079 1:21444711-21444733 AATGAAAAATAAGCTGAGCATGG - Intronic
903437838 1:23365421-23365443 AAATAAAAAGAAGCTGAGCATGG + Intronic
903510159 1:23868702-23868724 AAAAATAAACAAAATGAGCCTGG + Intergenic
903873620 1:26456214-26456236 AAAAATAAATTAGCTGAGCATGG + Intronic
903890697 1:26568451-26568473 AAAGATCAACAACTTGAGCCGGG + Intronic
903900188 1:26638687-26638709 AAAAAAAAACTAGCTGAGCACGG - Intergenic
903949635 1:26988490-26988512 AAAAATAAATTACCTGGGCATGG - Intergenic
904426161 1:30424533-30424555 AAAGATAAAAAAAATTAGCAGGG + Intergenic
904740085 1:32667539-32667561 AAAGAGAAAACACCTGAGCCTGG - Intronic
906184031 1:43846787-43846809 AAAAATAAATAAGCTGAGCACGG - Intronic
906286909 1:44593565-44593587 AAATAAAAACTACCTGGGCATGG + Intronic
906505934 1:46379644-46379666 AAACAAAAACAACTTGAGAATGG + Intergenic
907024402 1:51101319-51101341 AAAAATAAGCAAGCTGGGCATGG + Intergenic
907458421 1:54590908-54590930 ATAAATAAATAAGCTGAGCATGG - Intronic
907952159 1:59194128-59194150 AAAGATCAAAATCCTCAGCATGG + Intergenic
908040664 1:60109020-60109042 AAAGATAAACAGGCTGGGCGGGG - Intergenic
908505448 1:64793236-64793258 AATGATAAAGAAGCAGAGCAAGG - Intronic
908523854 1:64968952-64968974 AAAGGTAAACTAGCTGGGCATGG + Intergenic
908598467 1:65712709-65712731 AAAGAAAAACAACCTGAGTGTGG + Intergenic
909067564 1:70953929-70953951 AAAGATAAACAACATGGGCATGG + Intronic
909345897 1:74587033-74587055 AAAGATAAACAGGCTGGGCATGG + Intronic
909446398 1:75753949-75753971 AAAAAAAAAAAAGCTGAGCATGG - Intronic
911528390 1:99013661-99013683 AAAAAAAAACTAGCTGAGCATGG + Intergenic
911716376 1:101138240-101138262 AAAGTTAAACAACTTGCCCATGG - Intergenic
911824407 1:102462860-102462882 AAAGAAAAACAAGCTGGGCATGG - Intergenic
912313908 1:108649458-108649480 AAACAAAAAAAAGCTGAGCATGG + Intronic
912630790 1:111245011-111245033 AAAGATAAATAACATGCCCAAGG - Intergenic
913143319 1:115963623-115963645 AAAGATACAGAACCTCAGAACGG + Intergenic
913338908 1:117737258-117737280 AATGATAAATAAGCTTAGCAGGG - Intergenic
913409820 1:118538857-118538879 ATACATAAACAAAATGAGCATGG + Intergenic
913701679 1:121380530-121380552 GAAGTTAAACAATTTGAGCAAGG - Intronic
914729078 1:150354516-150354538 AGAGATAAGCAAGCTGAGCTTGG + Intergenic
915575864 1:156776211-156776233 AAAAATAAAATAACTGAGCATGG + Intronic
916623992 1:166533866-166533888 AAAGATAAATTAGCTGGGCATGG - Intergenic
916883962 1:169049007-169049029 AAATATCAACAAGCTGAGAATGG - Intergenic
917209245 1:172614755-172614777 AAATAAAAATAAGCTGAGCATGG + Intergenic
918124334 1:181569426-181569448 AAAGAAAATCAACTTGACCAAGG - Intronic
918532949 1:185543082-185543104 AAAGAAAAGAAACCTGAGCGTGG - Intergenic
919229775 1:194759250-194759272 TAAGTTAAACAACTTGACCAGGG + Intergenic
919365693 1:196658394-196658416 AAAAAAAAATTACCTGAGCAAGG - Intronic
919954292 1:202397328-202397350 AAAGAAAAACAAATTTAGCATGG - Intronic
920392790 1:205620651-205620673 AAAGATAAACCACCTCAGCCTGG - Exonic
921126795 1:212185173-212185195 GAAGATAGAAAACCTGAGCCAGG + Intergenic
921255925 1:213339411-213339433 AAAGATAACCCAGCTGAGCCTGG + Intergenic
921670766 1:217921511-217921533 AAAGATGAATAAACTGAGGATGG + Intergenic
921671759 1:217933012-217933034 AAAGTTACAGAACCTCAGCATGG + Intergenic
923168549 1:231391239-231391261 AAAGATATACCAGCTGGGCATGG - Intronic
923172198 1:231428441-231428463 AGAAATAAACTACCTGAGAATGG + Intergenic
924055786 1:240122755-240122777 AAAGAAAAAAAATCTGAGCTGGG + Intronic
924100461 1:240597814-240597836 AAAGATGAGCAACTTGGGCATGG - Intronic
1063616953 10:7608438-7608460 AAAGATAAACAAAATTAGCCAGG - Intronic
1063632663 10:7748695-7748717 AAAGAAAAATTACCTGGGCATGG - Intronic
1063838388 10:10042680-10042702 AGAGAGAAACAACTTGAGAATGG - Intergenic
1063839133 10:10049964-10049986 AAAAAAAAACTACCTGGGCATGG + Intergenic
1064469627 10:15622604-15622626 AAAAAAAAACCACATGAGCAAGG + Intronic
1064528205 10:16280486-16280508 GAAAATAAACAAGCTGAGCCCGG - Intergenic
1064737237 10:18394630-18394652 ATAGAGAAGCTACCTGAGCAAGG - Intronic
1065075311 10:22072791-22072813 GAAGATAAACAACCTGGGCAAGG + Intergenic
1065159067 10:22900390-22900412 AAAGTTAAACAAATTGAGAAAGG + Intergenic
1065400606 10:25296058-25296080 AAAAAAAAAAAACCTAAGCAAGG + Intronic
1065696281 10:28383257-28383279 AAACAAAAACTAGCTGAGCATGG - Intergenic
1066310268 10:34189184-34189206 AATAATAAATAACCTGGGCATGG + Intronic
1067409071 10:46048927-46048949 AATGATAATCAGCCTGGGCATGG - Intergenic
1067421200 10:46150482-46150504 AAAGATAAACAATCATAGAATGG - Intergenic
1067491050 10:46703141-46703163 AAAGATAAACAATCATAGAATGG - Intergenic
1067506537 10:46856941-46856963 AAAGATAAACAATCATAGAATGG - Intergenic
1067603615 10:47637225-47637247 AAAGATAAACAATCATAGAATGG + Intergenic
1068393755 10:56433731-56433753 AAAGATAAACAATCATAGAATGG + Intergenic
1069668218 10:70179169-70179191 AAAAATAAACAGGCTGGGCACGG + Intergenic
1069923915 10:71834944-71834966 AAAGAAAAACAGGCTGGGCACGG + Intronic
1070086256 10:73240077-73240099 AAAAATAAATTACCTGGGCATGG - Intronic
1070717709 10:78734632-78734654 AAAGACAACCAACCAGAGCCTGG + Intergenic
1070898239 10:80004457-80004479 AAAACTAAACAAGCTGGGCATGG + Intergenic
1071540712 10:86480942-86480964 AGAGATAAACAACCAGAGACTGG + Intronic
1071859152 10:89655001-89655023 ACAGATGAACAACCTGATGAAGG - Intergenic
1072365903 10:94709272-94709294 AAAGATAAGAAACATTAGCAAGG - Intronic
1072698435 10:97621702-97621724 AAAGATACAAAACATTAGCAGGG + Intronic
1072880421 10:99221612-99221634 AAGGAGAAAAAACTTGAGCAGGG + Intronic
1073879508 10:107964357-107964379 AAAGATAAAGAAGCTGAGCATGG - Intergenic
1074320712 10:112399415-112399437 ACAGATAGACAATCTGAGCCAGG + Intronic
1074409772 10:113217231-113217253 AAACAAAAGCAACATGAGCAAGG - Intergenic
1074871898 10:117583518-117583540 AAATAAAAACTAGCTGAGCATGG - Intergenic
1077292662 11:1805635-1805657 AAAGATAACCACCCTCATCAAGG + Intergenic
1077799161 11:5521341-5521363 AAAAATAAAAAAACTTAGCAGGG + Intronic
1077878764 11:6330453-6330475 AATCATAAACAAGGTGAGCAGGG + Intergenic
1078394921 11:10972559-10972581 AGAGAGAAACAAACTGAGAATGG + Intergenic
1078707232 11:13756187-13756209 AAAGATGAAGAACCTTAGGAAGG + Intergenic
1078975385 11:16468842-16468864 AAAAATACACAGCCTGAGCTAGG - Intronic
1080402486 11:31949063-31949085 AAAGATACAGAACCTCAGAATGG + Intronic
1081842645 11:46214376-46214398 AAAGAAAAAGAATCAGAGCAAGG - Intergenic
1081961225 11:47139001-47139023 AAAAAAAAAAAACCTGAGCTAGG + Intronic
1082176343 11:49064750-49064772 AAAGATAAACAAAATTAGCTGGG + Intergenic
1082865188 11:57893383-57893405 AAAGAGAAAGAACTTGTGCAGGG - Intergenic
1082967339 11:58979954-58979976 AAAAATAAACAAAATTAGCAGGG + Intronic
1082977520 11:59087684-59087706 AAAAATAAACAAAATTAGCAGGG + Intergenic
1083173861 11:60937586-60937608 AAATATAAACACCATGAGAAAGG + Intronic
1083529042 11:63400236-63400258 AAAAATAAACAACATCAACAAGG + Intronic
1083917114 11:65754576-65754598 AAAGAAAAACTAGCTGGGCATGG - Intergenic
1083926041 11:65807397-65807419 AAAAATAAACTAGCTGGGCACGG + Intergenic
1084014976 11:66372816-66372838 AAACATAAGCAACCTGGGAATGG - Intergenic
1084384550 11:68834841-68834863 AAACAAAAACTACCTGGGCATGG + Intronic
1084435965 11:69140007-69140029 AAAAATAAACAATCTGGGCCAGG - Intergenic
1084905030 11:72339074-72339096 ATAGATAAACATGCTGAACAAGG - Intronic
1086152582 11:83628457-83628479 ACAGCTAGACAACATGAGCATGG - Intronic
1086495930 11:87404504-87404526 AAAGATAGAAAACCTGAGGCTGG + Intergenic
1086928667 11:92668579-92668601 AAAGTTAAATAACTTGATCAAGG - Intronic
1087625997 11:100596769-100596791 AAAAATAAAAAAGCTGGGCATGG - Intergenic
1087794201 11:102438340-102438362 AAAAATAAATAAACTGGGCACGG - Intronic
1088030274 11:105240257-105240279 AAAGAGAAACAAGATGAGAAGGG + Intergenic
1088506134 11:110529338-110529360 AAGGTTAAACAACCTGCTCAAGG - Intergenic
1088948626 11:114541399-114541421 AAAGATAAGAAATCTCAGCAAGG + Intronic
1090347177 11:126080824-126080846 AAAGATAAATAACCTGCCCATGG - Intergenic
1090761391 11:129839693-129839715 AAAAATAAATTACCTGGGCATGG - Intronic
1091021579 11:132104747-132104769 AAAAATAAATTATCTGAGCATGG + Intronic
1092199263 12:6569836-6569858 AAAGTTAAACAACTTGCTCAAGG + Intergenic
1093255021 12:16856419-16856441 AATGATGAACAAACTGACCATGG - Intergenic
1093376965 12:18441091-18441113 AAATATAAACCAAGTGAGCATGG + Intronic
1094653002 12:32396020-32396042 AAAAAAAAAAAACCTGGGCACGG - Intergenic
1094785646 12:33845872-33845894 AAAGAGAAAGAACTTGTGCAGGG + Intergenic
1095362301 12:41357516-41357538 AAAGATGAACACAATGAGCATGG + Intronic
1095398863 12:41791761-41791783 AAAGTTAAACAGGCTGGGCATGG + Intergenic
1095464981 12:42480955-42480977 AAAGATAAAGAACCTGAGAGGGG + Intronic
1095957684 12:47816185-47816207 AAAGATAAAGATCCTGGGCCGGG - Intronic
1096055677 12:48649443-48649465 AAAAATAAAAAAGCTGGGCATGG - Intergenic
1096633947 12:52946916-52946938 ACAGATAAAGAGCCTGAGCCTGG - Intronic
1097482824 12:60152183-60152205 AAAGTTTAATAACCTGACCAAGG - Intergenic
1097509570 12:60520676-60520698 AAGGATAAGCAACTTGACCAAGG - Intergenic
1097764360 12:63508224-63508246 AGAAATAAAAAACCTGAACAGGG + Intergenic
1098215749 12:68215972-68215994 AAAGATAAATAGGCTGAGCATGG - Intronic
1098268718 12:68749869-68749891 AAAGATATACTTCCTTAGCATGG - Intronic
1098506498 12:71257978-71258000 AAAAATGAACAGGCTGAGCATGG + Intronic
1098975839 12:76900993-76901015 AAAAAAAAAAAACCAGAGCAAGG + Intergenic
1099336738 12:81370217-81370239 AAAGATAAAAAAACTAAGCCTGG + Intronic
1099373758 12:81870987-81871009 TAAAATAAATAACCTGAACAGGG + Intergenic
1100305380 12:93345463-93345485 AAAAACAAACAAGCTGGGCACGG - Intergenic
1100518548 12:95351653-95351675 CAAGATGAACACCCTGTGCATGG + Intergenic
1101589700 12:106114699-106114721 AGGGATAAACACTCTGAGCAAGG + Intronic
1102442049 12:112970976-112970998 AGAGAGAAACAGGCTGAGCACGG - Exonic
1102490707 12:113288153-113288175 CAACTTAAACAACCTGAGCGAGG - Exonic
1102560412 12:113758118-113758140 AAAGACAAAAAAGCTGGGCATGG - Intergenic
1102671348 12:114621789-114621811 ATAGATGTACAACCTGGGCAGGG - Intergenic
1102925696 12:116824462-116824484 AAAGATAAGCAGCCCGAGCCTGG + Intronic
1103076459 12:117986652-117986674 AAAGAAAAAGAAACTCAGCAAGG + Intergenic
1103355999 12:120320914-120320936 AAACATTAACAAGCCGAGCATGG - Intergenic
1103667782 12:122583830-122583852 AAAGAAAAACAGGCTGGGCACGG + Intronic
1103695882 12:122815082-122815104 ACAAATAAATAAGCTGAGCATGG - Intronic
1103773199 12:123345063-123345085 AAAGCTAAACAACCTACCCAAGG + Intronic
1103888887 12:124223586-124223608 AAAGTTAAACAGGCTGGGCACGG + Intronic
1104693884 12:130848646-130848668 AAAGAAAAACAGGCTGGGCATGG + Intergenic
1105908467 13:24836917-24836939 AAAGATACAGAACCTCAGAATGG + Intronic
1106675574 13:31954500-31954522 AAAAACAAACAAACTGGGCATGG + Intergenic
1107100346 13:36583491-36583513 AAATATTATCAACCTGAACAAGG - Intergenic
1107845642 13:44509978-44510000 AAAAAAAAATAACCTGGGCAAGG + Intronic
1107860223 13:44653633-44653655 AAAGATAAAGAAGCTGAGGATGG + Intergenic
1107933672 13:45327013-45327035 AAAAATAAAAAAACTAAGCAAGG + Intergenic
1108069505 13:46613744-46613766 AAACATATACAACATAAGCAGGG + Intronic
1108191461 13:47944675-47944697 AAAAATAAAGAATTTGAGCAAGG - Intronic
1108245923 13:48514058-48514080 AAATCTTAACAACCTCAGCATGG + Intronic
1108999770 13:56783896-56783918 AAAAATGAACAAATTGAGCATGG + Intergenic
1109066603 13:57702205-57702227 AAAGAAAAACAGGCTGGGCATGG - Intronic
1109960667 13:69625002-69625024 AAATATACACAACCTGATAATGG + Intergenic
1110907836 13:80915513-80915535 GCTGATAAACAACCTCAGCAAGG + Intergenic
1111582163 13:90236554-90236576 AAAGAAAAACAGGCTGGGCACGG - Intergenic
1111875594 13:93890307-93890329 TAAGATAAGGAACCTGTGCATGG - Intronic
1112170310 13:96966408-96966430 AAAGAAAAAAAACCTAACCAAGG - Intergenic
1112180879 13:97079065-97079087 ACAAAGAAATAACCTGAGCAGGG + Intergenic
1113027187 13:105954015-105954037 AAACATAAATTAGCTGAGCATGG - Intergenic
1113335943 13:109375999-109376021 AATAATAAAATACCTGAGCATGG - Intergenic
1113570826 13:111356017-111356039 AAAGATAAACCACCTGAGTTGGG - Intergenic
1114455351 14:22850103-22850125 AAAGATAAATAACTTGGTCAAGG + Intergenic
1114569698 14:23657966-23657988 AAAGAAAGACAACCCCAGCAGGG - Intergenic
1114661212 14:24346263-24346285 AAAAAAAAAAAAGCTGAGCATGG + Intergenic
1114980093 14:28152367-28152389 AAAGAAAACAAAACTGAGCAGGG + Intergenic
1116257738 14:42578641-42578663 ACAGGGAAACAACATGAGCAGGG - Intergenic
1117356886 14:54932771-54932793 AAAAAAAAACCAGCTGAGCACGG + Intergenic
1117735450 14:58764391-58764413 AAAGTTAAACAAAATAAGCAAGG - Intergenic
1118246525 14:64116013-64116035 AAAAATAAACTAGCTGGGCATGG + Intronic
1118903862 14:70008972-70008994 AAAGAGACAGAAACTGAGCAGGG - Intronic
1119374762 14:74180949-74180971 ATAGAAAAATTACCTGAGCATGG + Intronic
1120006204 14:79360685-79360707 TCAGATAAACAATCTGAGTATGG + Intronic
1120585671 14:86309148-86309170 AAAGATAGACAAGCCGGGCACGG + Intergenic
1120714762 14:87829004-87829026 AAAGATAAAAAGTCTCAGCAAGG - Intergenic
1121205753 14:92165635-92165657 AAAGATAAACAAATTGAAAATGG - Exonic
1121834881 14:97083088-97083110 AAAGATGAACCAGCAGAGCACGG - Intergenic
1121898328 14:97669870-97669892 AAAGAAAAATTAGCTGAGCATGG - Intergenic
1122670179 14:103365778-103365800 AAAGAAAAACAGGCTGGGCATGG - Intergenic
1123764078 15:23457509-23457531 AGAGATAAACTATCTGAGAAAGG + Intergenic
1124423803 15:29545344-29545366 AAAGGTCAAGAACATGAGCATGG + Intronic
1124628378 15:31323527-31323549 AAAGACATACAACCTGTGAAGGG - Intergenic
1124921022 15:34026627-34026649 AAAGATAGACAATCAGAACAAGG + Intronic
1125121476 15:36163953-36163975 AAAGCTAAACAACCTCAGAAAGG - Intergenic
1125176322 15:36826325-36826347 AAAGAAAAATTAGCTGAGCATGG + Intergenic
1125307488 15:38336212-38336234 AAAAAGAAACAACTTGAACATGG - Intronic
1125820845 15:42629178-42629200 AAAAATAAACAAAATTAGCAGGG - Intronic
1125845519 15:42849344-42849366 GAAGATAGACAATCTTAGCAAGG - Intronic
1126472831 15:49033535-49033557 AAATATAAAAAAGCTGATCATGG + Intronic
1127223288 15:56903239-56903261 AAAAATACAAAACATGAGCATGG + Intronic
1128881781 15:71250474-71250496 AAATAAAAATAAGCTGAGCATGG - Intronic
1130110122 15:80957113-80957135 GAAGATGAAGAAGCTGAGCATGG - Intronic
1130139333 15:81210706-81210728 ACTGATAAACAACTTTAGCAAGG - Intronic
1131031097 15:89186597-89186619 AAAGAAAAGCAACTTGGGCATGG - Intronic
1131592091 15:93760844-93760866 CAAGAGATAAAACCTGAGCAAGG - Intergenic
1131779404 15:95840491-95840513 ACAGATAAAAAAACTGAGGAGGG + Intergenic
1133079882 16:3310236-3310258 ATACATAAACTAGCTGAGCATGG + Intronic
1133127030 16:3653829-3653851 AAAAAAAAAAAAACTGAGCATGG + Intronic
1133329191 16:4960949-4960971 AAAAACATACAACCAGAGCATGG - Intronic
1133446774 16:5868000-5868022 AAAGAAAAACAGGCTGGGCATGG - Intergenic
1133674211 16:8054991-8055013 ACAGATAAACAAACTTAGAAAGG + Intergenic
1133794141 16:9032804-9032826 AACGAAAAACAAGCTGGGCATGG + Intergenic
1133999362 16:10770580-10770602 AAACAAAAACAAGCTGGGCACGG + Intronic
1135965580 16:27032381-27032403 AAAAAAAAAGAAGCTGAGCATGG - Intergenic
1136112576 16:28074051-28074073 AAAGAGAAACAACCTGCCCAAGG + Intergenic
1136421546 16:30137079-30137101 ATAAATAAATAAGCTGAGCATGG + Intergenic
1136563189 16:31053341-31053363 AAAAATAAACAAAATTAGCAGGG - Intergenic
1137254525 16:46764077-46764099 AAAGATAAAAAACATTAGCCAGG + Intronic
1137627084 16:49916092-49916114 AGGGATAAACAACATTAGCAGGG - Intergenic
1138149554 16:54643569-54643591 AGACATAAAAAAGCTGAGCAAGG - Intergenic
1138572699 16:57885752-57885774 AAAGATACAAAACCTTAGCCAGG - Intronic
1139118368 16:63985053-63985075 AAATAAAAACTAGCTGAGCATGG - Intergenic
1139745149 16:69068146-69068168 AAAAAAAAATTACCTGAGCATGG + Intronic
1140074964 16:71689803-71689825 AAAGATAAATAAGCTGGGCGTGG - Intronic
1140262841 16:73395521-73395543 AAAGAAAAACAAGCAGAGCACGG - Intergenic
1140649784 16:77075408-77075430 AAAGCTATACAACGTGACCATGG - Intergenic
1140824167 16:78690389-78690411 AAAAATAAACAAACTTAGCCAGG + Intronic
1141551318 16:84808552-84808574 AAAAATAAAAAACCTTAGCTGGG - Intergenic
1141877991 16:86839471-86839493 CAAGCTAAATAACCTGACCAAGG + Intergenic
1141921279 16:87137188-87137210 AAAAAAAGACAACCTGACCATGG - Intronic
1142359682 16:89620190-89620212 ACAGATAAAGAAACTGAGGACGG + Intronic
1142848460 17:2693146-2693168 AAAAAAAAAAAGCCTGAGCAGGG + Intronic
1143923042 17:10346101-10346123 AAAGGTGAACAACATGAGCTGGG - Intronic
1144402385 17:14918796-14918818 AAAGATAAACAAACAGCCCAGGG + Intergenic
1144719547 17:17458885-17458907 ATACATAAACAACATGGGCACGG + Intergenic
1145242185 17:21246529-21246551 AAAAAAAAAAAAGCTGAGCATGG + Intronic
1146046163 17:29509738-29509760 AAAAATAAATTAGCTGAGCAGGG + Intronic
1146434177 17:32828027-32828049 AAAGACCAAAACCCTGAGCATGG + Intronic
1147221279 17:38931923-38931945 AAAAAAAAAAAACCTGGGCATGG + Intergenic
1148005953 17:44429706-44429728 AAACAAAAACCAGCTGAGCATGG + Intronic
1148459765 17:47832531-47832553 AAAAATAAACTAGCTGAGCATGG + Intronic
1148572678 17:48682971-48682993 AAAAATAAACAAAATTAGCAGGG - Intergenic
1148845145 17:50525640-50525662 AAAGAGAAATTAGCTGAGCATGG - Intronic
1148871236 17:50659823-50659845 AAAAATAAACAAGATGAGCCGGG + Intronic
1148959131 17:51378657-51378679 AAAGAAAAACAACCAAAGAAAGG - Intergenic
1149129801 17:53284562-53284584 ATAAATAAACAACCTGAGACCGG + Intergenic
1149165666 17:53749212-53749234 AAAGAGAAATAAACTGAGCAAGG + Intergenic
1149546289 17:57506214-57506236 AAAGAGAAAGAGCCGGAGCAGGG - Intronic
1150076013 17:62192731-62192753 AAAGAAAAATTAGCTGAGCATGG - Intergenic
1150547424 17:66174216-66174238 AAAGATAAACAGGCCGGGCATGG - Intronic
1150800327 17:68276742-68276764 AAAGTTAACCAAGCTGGGCATGG - Intronic
1151136038 17:71946434-71946456 AGAGATAAACAGCCAGAGAAGGG + Intergenic
1151146050 17:72042333-72042355 AAAAAAAAAAAACCTGATCATGG + Intergenic
1151523001 17:74644245-74644267 AAAGATAGAAAATCTCAGCAAGG + Intergenic
1151523382 17:74647047-74647069 AAAGAAAAAGAACAAGAGCAGGG + Intergenic
1151630271 17:75306185-75306207 AAAGATAAACAAGAAGAGCCAGG + Intergenic
1152825311 17:82461068-82461090 AAAAATAAATTAGCTGAGCATGG - Intronic
1153236289 18:2991549-2991571 AAACATAAACAAAATGAGCCAGG + Intronic
1153244572 18:3061159-3061181 AAAAATAAATTAGCTGAGCATGG - Intergenic
1153672104 18:7421153-7421175 AAAGGTAACAAACCTAAGCAAGG - Intergenic
1155386055 18:25278622-25278644 AAAGATAAACAACCTGAGCAAGG - Intronic
1156582069 18:38389132-38389154 AAAAATAAACTAGCTGGGCATGG + Intergenic
1157090292 18:44628699-44628721 AAAAAAAAAAAACCTGTGCAGGG - Intergenic
1157809456 18:50684388-50684410 AAAAATAAATTAGCTGAGCATGG + Intronic
1157932517 18:51839129-51839151 AAATATAAACATCTTAAGCAAGG - Intergenic
1158118372 18:54022430-54022452 GAAGTTAAACAACCTGTTCATGG - Intergenic
1158187356 18:54785426-54785448 AAAAAAAAAAAACCTGAGGAAGG - Intronic
1158600496 18:58852243-58852265 AAAGAAAAACAAACTGAGTTTGG - Intergenic
1158602854 18:58870059-58870081 AAAAAAAAACAACCTGGGCTGGG - Intronic
1159192112 18:65059811-65059833 AAAAAAAAAAAAGCTGAGCATGG - Intergenic
1159616070 18:70581303-70581325 AAAGAAAAACAGGCTGGGCACGG + Intergenic
1161880925 19:6951745-6951767 AAAAATACACAACATGAGCTGGG + Intergenic
1161916163 19:7229919-7229941 AAAGAAAAATTAGCTGAGCATGG - Intronic
1162469829 19:10865966-10865988 AAAAATAAACTAGCTGGGCATGG - Intronic
1162561443 19:11420125-11420147 AAAAAAAAAAAAGCTGAGCATGG - Intergenic
1163169608 19:15521824-15521846 AAGATTAAACAAGCTGAGCATGG - Intronic
1163414801 19:17179741-17179763 AAAAATAAATAGGCTGAGCAGGG + Intronic
1164607686 19:29611814-29611836 AAAGTTAGACAACATGAGCTTGG - Intronic
1164741456 19:30578958-30578980 AAAGCTAAGCAGCCTGACCAAGG - Intronic
1164997995 19:32737498-32737520 AAAAATAAACTACCTGGGCCAGG - Intronic
1167488072 19:49774931-49774953 AAAGCAAAACAGGCTGAGCATGG + Intronic
1168001091 19:53446666-53446688 AAAAATAAAAAAACTGAGCCAGG - Intronic
926461855 2:13139945-13139967 AAAGAAAAAAAAACTGACCAAGG - Intergenic
927075550 2:19573613-19573635 AATGATAAACAAACTCAGCTAGG - Intergenic
927313109 2:21652359-21652381 ACATTTAAACAACCTCAGCATGG - Intergenic
927549031 2:23980915-23980937 AAATATAAACAGGCTGAGCACGG - Intronic
928043156 2:27898966-27898988 AAAACCAAACAACCTGAGCTGGG + Intronic
928465836 2:31521471-31521493 AAAGAAAAACAACTTGACCAGGG - Intergenic
929002166 2:37358120-37358142 AAAAAGAAACAGCCTGGGCATGG + Intronic
929044228 2:37774946-37774968 AAAGAGAAACAACCAGGACAAGG + Intergenic
929185050 2:39085199-39085221 AAAGAAAAATTAGCTGAGCATGG - Intronic
930123276 2:47777186-47777208 AAAAATAAACCAGCTGGGCATGG - Intronic
931439162 2:62275482-62275504 AAAGAGAGAGAACCTGTGCAGGG - Intergenic
931599156 2:63985522-63985544 AAAGATAAACAACTTCCTCAAGG + Intronic
932954456 2:76335610-76335632 AAAGATACAGAACCTTAGAATGG - Intergenic
933742033 2:85541044-85541066 AAAGTTAAAGAAACTGAGCCAGG + Intronic
934092899 2:88569377-88569399 AAAGATGAACAATGTGAGAATGG + Intronic
934579859 2:95429257-95429279 AAAAATAAACAGCCTAAGCAGGG + Intergenic
934599588 2:95647468-95647490 AAAAATAAACAGCCTAAGCAGGG - Intergenic
935181426 2:100694145-100694167 AAAGCAAAACAACTGGAGCAAGG + Intergenic
936087974 2:109482455-109482477 GAAGATAAACAGCCACAGCACGG - Intronic
937840145 2:126516978-126517000 AAAAATAAATTATCTGAGCATGG + Intergenic
937987511 2:127644765-127644787 GAAGCTAACCACCCTGAGCAGGG - Intronic
938043649 2:128097213-128097235 AAAGATACACAAAATTAGCAGGG + Intronic
938290320 2:130145546-130145568 AAAGAAAAAAAACCCGGGCATGG + Intergenic
938315395 2:130323196-130323218 TATGATAAACAACTTCAGCAGGG - Intergenic
938466214 2:131527419-131527441 AAAGAAAAAAAACCCGGGCATGG - Intergenic
939184030 2:138839716-138839738 AGAAATAAACCACCTGAACATGG - Intergenic
940275613 2:151937485-151937507 AAATATAAATAAACTGAGAAGGG - Intronic
941405500 2:165082855-165082877 AAGGAAAAGCAATCTGAGCAGGG - Intergenic
942957306 2:181788208-181788230 AAAGACAAACTAGCTGGGCACGG + Intergenic
942981694 2:182091712-182091734 AAAGAAAAACAAGCAGGGCATGG - Intronic
943308828 2:186301317-186301339 AAAAATAAATGAGCTGAGCATGG + Intergenic
943546419 2:189285151-189285173 AAAGATAAAAACACAGAGCAAGG + Intergenic
943887933 2:193246564-193246586 AAAGATAAATATCCCAAGCATGG - Intergenic
944484289 2:200188153-200188175 AAAAATAAAGTAGCTGAGCATGG + Intergenic
947062899 2:226186741-226186763 AAAGATAAACAGCCTGGGCACGG + Intergenic
947411307 2:229843434-229843456 AAACAAAAACAGGCTGAGCATGG + Intronic
948347510 2:237311388-237311410 AAAGAAAAACAGTCTGGGCACGG + Intergenic
1168962799 20:1880490-1880512 AAAGATGGACAACCTCAGGATGG + Intergenic
1169001582 20:2171692-2171714 AAACAAAAACAGCCTGGGCACGG + Intronic
1169185956 20:3617526-3617548 AATGAAAAAGAAGCTGAGCATGG + Intronic
1169448860 20:5694356-5694378 ACAGATGCACAACCTAAGCAGGG - Intergenic
1169502330 20:6172883-6172905 AAAGATAAAGAACCCCAGAAGGG - Intergenic
1169546048 20:6652042-6652064 AAAAATAAAAAATCTGAGCTGGG + Intergenic
1169603989 20:7294596-7294618 AAGGAGATACAAACTGAGCAGGG - Intergenic
1169820752 20:9707272-9707294 AAAAATAAATTAACTGAGCATGG - Intronic
1170226129 20:13994018-13994040 AAAGAAAAACAGGCTGGGCACGG + Intronic
1172458675 20:35098573-35098595 AAAGAAAAAAAGCCTGGGCATGG - Intergenic
1172552153 20:35809591-35809613 AAAGATAATCCAGCTGGGCATGG + Intronic
1172653182 20:36519944-36519966 AAAAAAAAACAAACTGGGCATGG - Intronic
1172988380 20:39011955-39011977 AAAGATAAACAGGCTGAGCGTGG + Intronic
1173696188 20:45015722-45015744 AAAAAGAAAGAACCTGACCAAGG - Intronic
1173921253 20:46747077-46747099 AAAGATAGGCTAACTGAGCAAGG - Intergenic
1174322622 20:49753998-49754020 AAAAAAAAAAAACCTGGGCATGG - Intergenic
1174441323 20:50557394-50557416 AAAGATAAACATTTTGAGCTGGG - Intronic
1174993130 20:55535349-55535371 AAAGAAAAAATAGCTGAGCATGG - Intergenic
1177182146 21:17756001-17756023 AAAAATAAGCAGCCTGGGCACGG - Intergenic
1178083670 21:29091934-29091956 AAAGATGAAGAAACTGAGCATGG + Intronic
1178299808 21:31442850-31442872 AAAGAAAAATAAGCTGAGGAAGG + Intronic
1178747325 21:35265643-35265665 AAAAATAAACAAGCCGAGCATGG + Intronic
1178947626 21:36960975-36960997 AAAGATAATGAACATGAGGATGG + Intronic
1179424029 21:41258820-41258842 AAAGATAAAAAACATGACAATGG - Intronic
1181962919 22:26635939-26635961 AAAAACAAAAAACCTGGGCATGG - Intergenic
1182290666 22:29276809-29276831 AAAAATAAACAAACTTAGCTGGG - Intronic
1183467761 22:37988353-37988375 AAAGAAAAACATACTGAGCCAGG + Intronic
1183561916 22:38581732-38581754 AAAAAAAAAAAACCTGAGCCAGG - Intronic
1183839660 22:40488206-40488228 AGAGATGAACAACATGAGCTAGG + Intronic
1183882051 22:40841212-40841234 AAAAAAAAACAAGCTGGGCATGG + Intronic
1183973342 22:41495180-41495202 AAACATAAATTAGCTGAGCATGG - Intronic
1184363921 22:44037184-44037206 AAAGAAAAAACAGCTGAGCATGG + Intronic
1184623718 22:45704910-45704932 AAAGTTTATCATCCTGAGCAAGG - Intronic
1203296342 22_KI270736v1_random:46333-46355 AAAGAGAAACAACCAGGACAAGG + Intergenic
949093749 3:61217-61239 AAATATAAAAAACCTGAACCTGG - Intergenic
949388546 3:3533343-3533365 AAAGATGAACAGTTTGAGCACGG - Intergenic
949690450 3:6631042-6631064 TAAGATAAAAAACATGAGCTGGG - Intergenic
950237447 3:11335856-11335878 AAAGATACAAAAACTTAGCAAGG - Intronic
950246011 3:11419260-11419282 ATAGACAAACAAGCTGGGCATGG + Intronic
951974425 3:28488244-28488266 AATCACAACCAACCTGAGCAGGG - Intronic
952551229 3:34480091-34480113 ATTAATAAACAAGCTGAGCAAGG - Intergenic
953551197 3:43904702-43904724 AAAAAGAAAGAAACTGAGCAAGG + Intergenic
954773439 3:52995549-52995571 AAACATAAACAAAGTTAGCAAGG - Intronic
955284981 3:57631642-57631664 AAGGCTAAATAACCTGACCAAGG + Intronic
955474799 3:59325777-59325799 AAACAAAAAAAACCTGAGCCTGG + Intergenic
955551027 3:60085748-60085770 AAAGATAAACAACTTGTCCAAGG - Intronic
955590974 3:60534752-60534774 AAATATAAAGTAACTGAGCAGGG + Intronic
955734325 3:62020826-62020848 AAACAAAAAAAACCTGTGCATGG - Intronic
955771510 3:62389397-62389419 AAAAATAAAATAGCTGAGCATGG - Intergenic
956122822 3:65983073-65983095 AAACAAAAATAACCTGGGCATGG - Intronic
956435686 3:69232521-69232543 AAAGAAAAACAGCCTGTGAAAGG - Intronic
958067741 3:88565986-88566008 AAAGATATACAGGCTGCGCACGG + Intergenic
959082282 3:101814933-101814955 ACAGCTAAACAACTTGACCAAGG - Intronic
959702368 3:109310244-109310266 AAAGAAAAATTACCTGGGCATGG + Intronic
959963632 3:112330553-112330575 AAAAATAAATTACCTGAACATGG - Intergenic
960434133 3:117604748-117604770 ACAGATAAAAATCTTGAGCAGGG + Intergenic
961534416 3:127560952-127560974 AAAGAAAAACAAGCAGAGAAGGG - Intergenic
962765546 3:138559440-138559462 AAACAAAAACAAGCTGAGCCTGG + Intronic
962941981 3:140133448-140133470 AAACACAAGTAACCTGAGCATGG - Intronic
963211830 3:142701164-142701186 AAAGATGAAGAACCTATGCAAGG - Intronic
963975512 3:151475841-151475863 AAAGCTGAACACCTTGAGCAAGG - Intergenic
964850207 3:161087957-161087979 ACAGATGAACAACATGAGGAAGG + Intronic
965538125 3:169846357-169846379 AGAAATAAACAGCCTGGGCACGG + Intronic
965904530 3:173687129-173687151 TAAGGTAAACAACCTGATCGTGG - Intronic
966218731 3:177529372-177529394 ACAGATAAAGAAACTGAGGAGGG - Intergenic
966303192 3:178501211-178501233 AAAAAAAAAGAACCTGACCATGG + Intronic
967240731 3:187436787-187436809 AAAGATAAAGAATCTGAGTAAGG - Intergenic
967311712 3:188112360-188112382 TGAGATAAGCAACCTGAGGAAGG - Intergenic
967560600 3:190913928-190913950 AAAAATCAACAAACTGAGCATGG - Intergenic
968329721 3:197856675-197856697 AAGAATAAACAAGCTGGGCACGG - Intronic
970515523 4:16825703-16825725 ACAGAAAAACATCCAGAGCACGG + Intronic
970820801 4:20210271-20210293 AATGATGAACAAACTGGGCAAGG + Intergenic
972015589 4:34240635-34240657 AAAGATAAACAGCCAGTGAAGGG + Intergenic
972533737 4:39982432-39982454 AAAAAAAAAAGACCTGAGCACGG + Intergenic
975034156 4:69660259-69660281 AAAGATACAGAACCTCAGAATGG + Intergenic
975159717 4:71111514-71111536 AAAAAAAAAAAACCTGAGCGTGG - Intergenic
975194081 4:71502255-71502277 AAAGATAAACAAAATCAGCCGGG - Intronic
975351500 4:73352126-73352148 AAACAAAAACAAGCTGGGCACGG - Intergenic
975921965 4:79401915-79401937 AAAGAGAAACAAGGTGAGGAAGG - Intergenic
977786745 4:101043952-101043974 AAAGTAAAATAACCTGACCATGG + Intronic
979094796 4:116533856-116533878 AGATATCATCAACCTGAGCAAGG - Intergenic
979358940 4:119738947-119738969 AAAAACAAACAACCTAACCATGG + Intergenic
980191048 4:129525563-129525585 AAGGATTAACAAACTGTGCATGG + Intergenic
980220732 4:129910492-129910514 AAATACAATCAACCTAAGCAGGG - Intergenic
981093813 4:140758564-140758586 AAAAATAAACAGGCTGGGCATGG + Intergenic
981335531 4:143564994-143565016 AAAAAAAAACAGGCTGAGCATGG - Intergenic
981586655 4:146310746-146310768 ACAGTTAAACAACCTGGACAAGG + Intronic
981602320 4:146504222-146504244 AAAGATAACCAAAATGGGCAGGG + Intronic
981714367 4:147738208-147738230 AAAGCTAAGCAGCTTGAGCAAGG - Intronic
981794734 4:148583643-148583665 AAAAAGAAAAAACCTGAACATGG - Intergenic
982013345 4:151128064-151128086 ATAGACAGACAAACTGAGCATGG + Intronic
982109001 4:152036108-152036130 AAAGTCTAACAAACTGAGCATGG - Intergenic
982316658 4:154038580-154038602 AATGAAAAAGAACATGAGCATGG + Intergenic
982552185 4:156816630-156816652 AAAGATAAGTAACTTGAACAAGG + Intronic
982697608 4:158621150-158621172 AAATAAAAATTACCTGAGCATGG + Intronic
983973040 4:173897648-173897670 AAAGATAATCAACCTGATCATGG + Intergenic
985257827 4:188086992-188087014 AAAGATAAATTAGCTGGGCATGG - Intergenic
986659691 5:10047894-10047916 AAAAAGAAACAACCAGGGCATGG + Intergenic
986814079 5:11389260-11389282 ACAGATAAACAACCCCATCAAGG + Intronic
987535446 5:19181756-19181778 ATAAATAAACAACCTCAGAAAGG + Intergenic
990605434 5:57404997-57405019 AAAGACAAACAACCAAACCAAGG + Intergenic
990976680 5:61566866-61566888 AAAGATAAAGAATCTAGGCAAGG - Intergenic
991492921 5:67200814-67200836 AAAAATAAACAGGCTGGGCATGG - Intergenic
992402216 5:76421915-76421937 ATAGCTAAACAACATGAGCTAGG - Intronic
993229404 5:85212784-85212806 AAAAATAGACAAACTGACCAAGG + Intergenic
993739454 5:91519606-91519628 AAAAATAAACTAGCTGGGCATGG - Intergenic
994126607 5:96174119-96174141 GAAGATAAAGAATCTGAGGAAGG + Intergenic
994156516 5:96509574-96509596 AAAGAAATATAACATGAGCATGG + Intergenic
994189861 5:96857573-96857595 AAAGATAAGGAAACTGAGCATGG + Intronic
994523545 5:100874061-100874083 AAAGAGAAAGAACCTAAGAAAGG + Intronic
994828682 5:104748057-104748079 AAAGAGAAAGAACTTGTGCAGGG - Intergenic
994921145 5:106045805-106045827 AAAAAAAAACTACCTGGGCATGG - Intergenic
995148892 5:108819169-108819191 AAAAAAAAAAAAGCTGAGCATGG - Intronic
995356260 5:111241254-111241276 AAAGACTAAGAAACTGAGCAAGG - Intronic
997090706 5:130853926-130853948 AAAGATAAGCAAAGTAAGCATGG + Intergenic
997132134 5:131287616-131287638 AAAGAAAAAAAAGCTGGGCATGG - Intronic
997259874 5:132457570-132457592 AAACATAAACACCCTGAGTCTGG + Intronic
997538579 5:134642161-134642183 AAAGATAAACAGGCTGGGCACGG + Intronic
997806025 5:136918853-136918875 AAATATAAACTAGCTGGGCATGG - Intergenic
998035985 5:138916516-138916538 AAAGACAAACAAGCTGGGCGTGG - Intronic
998246463 5:140510975-140510997 AAATAAAAAAAATCTGAGCATGG - Intronic
998676944 5:144420110-144420132 AAATATAAACACCATGAGGAAGG - Intronic
998930493 5:147176026-147176048 GAAGTTAAACAACCTGCCCAAGG - Intergenic
999202293 5:149825011-149825033 AAGGATAAACAGCCTGACCTGGG + Intronic
999638978 5:153651930-153651952 AAAGATTAAAAACCTGGTCAAGG - Intronic
1000857374 5:166415897-166415919 AATAATAAACTAGCTGAGCATGG - Intergenic
1001463298 5:171938215-171938237 AAAAATAAATTACCTGGGCATGG - Intronic
1002497614 5:179625922-179625944 ATAAATAAATAATCTGAGCAAGG - Intronic
1005569678 6:27132781-27132803 AAGGAAAAACAGCGTGAGCAGGG + Intergenic
1005617198 6:27585424-27585446 AAAGATTAACATCGTGAGCCGGG + Intergenic
1005625499 6:27658692-27658714 AAAGAAAAACAGGCTGGGCACGG + Intergenic
1007439451 6:41845529-41845551 AAAGGTAAATAAGCTGGGCATGG + Intronic
1007535392 6:42582988-42583010 AAAGATAAACAACCCAAAAATGG - Intronic
1008256034 6:49301168-49301190 AAAGATAAACAACATGAGGAAGG - Intergenic
1008919937 6:56832392-56832414 AAAGAGAAAGAACTTGTGCAGGG - Intronic
1008945880 6:57096474-57096496 TAAGATAAACAGGCTGGGCACGG - Intronic
1009408265 6:63334985-63335007 AAAAAAAAACTAGCTGAGCATGG + Intergenic
1009958735 6:70492393-70492415 AAATATAAACAATCTGATCTTGG + Intronic
1010918662 6:81652856-81652878 AAAAAAAAAAAACGTGAGCATGG + Intronic
1011430276 6:87278974-87278996 AAACATAAAAAATCTCAGCAGGG - Intergenic
1012469536 6:99555592-99555614 AAAGAAAAACTAACTGGGCATGG - Intronic
1012866861 6:104628338-104628360 AAAGATACACAGCCTGACTAAGG + Intergenic
1013553978 6:111237440-111237462 AAAGATAAATAAACTGTGCATGG - Intergenic
1013829825 6:114258047-114258069 AAATAGAAACAAGCTGGGCATGG - Intronic
1014964470 6:127729977-127729999 AAAGATAAACTGGCTGAGCATGG + Intronic
1015684436 6:135843887-135843909 AAAAATAAATTAGCTGAGCATGG - Intergenic
1016341959 6:143071937-143071959 AAAAAAAAACAATCTGGGCACGG - Intronic
1018153827 6:160966246-160966268 AAAAAAAAACAAACTGGGCATGG - Intergenic
1018963747 6:168467300-168467322 AAAAAAAAAAAACCTTAGCAGGG - Intronic
1019375299 7:688108-688130 AAAAAAAAAAAAGCTGAGCACGG + Intronic
1019864748 7:3697161-3697183 TAAGATAAACAAACCTAGCATGG - Intronic
1020283045 7:6660536-6660558 AAAAATAAACAACATTAGCCAGG + Intergenic
1020404949 7:7822379-7822401 AAAAAAAAACAACCCGAGCCTGG + Intronic
1020863129 7:13520121-13520143 AAAAATAAACTAGCTGGGCACGG - Intergenic
1021089644 7:16468123-16468145 AAATAAAAACTAGCTGAGCATGG + Intronic
1023283795 7:38597561-38597583 AAAGATAATTCACCTCAGCATGG - Intronic
1023358393 7:39390807-39390829 AGAGTTAAACAAGCTGAACAGGG + Intronic
1023388083 7:39680418-39680440 ATATATAAACTAGCTGAGCATGG + Intronic
1024753334 7:52496061-52496083 AAAGAAAAACAGGCCGAGCACGG - Intergenic
1024823333 7:53360118-53360140 AAAGAGAAATAATCTGAGGAGGG - Intergenic
1025151745 7:56560269-56560291 AAAGAAAGAAAAGCTGAGCATGG - Intergenic
1025688370 7:63738814-63738836 AAAAAGAAAAAACATGAGCATGG + Intergenic
1025997616 7:66537920-66537942 AAAAAAAAAAAACCTGGGCATGG - Intergenic
1026263696 7:68777787-68777809 AAAGAAAAACAAATTGAGCCTGG + Intergenic
1026349824 7:69506034-69506056 AAAAAAAAACATCCTGAGCTCGG + Intergenic
1026539738 7:71269309-71269331 AAAGAAAAATAAGCTGGGCATGG + Intronic
1026655332 7:72251558-72251580 AAAAATAAACAAAATGAGCCGGG - Intronic
1027740617 7:81999629-81999651 AAAAATAAACAACCTGAAAATGG - Intronic
1027745099 7:82062895-82062917 AAAGAAAAACCAGCTGGGCATGG - Intronic
1027808639 7:82863059-82863081 AAAGATAAACAAACACATCATGG - Intronic
1028403678 7:90452874-90452896 AAAAATAAACAACACTAGCAAGG - Intronic
1028528667 7:91814038-91814060 AAAGATAAACCAGCTGGTCATGG + Intronic
1028807117 7:95040611-95040633 AAAGCAAAATAACCTGAGTAAGG - Intronic
1028993263 7:97073406-97073428 AAAGATAAAGAACCACAGAATGG - Intergenic
1028996747 7:97109375-97109397 AGAGATAAACACTATGAGCAGGG + Intergenic
1029149244 7:98468391-98468413 AAAGAAAAACTACCTGAGACTGG - Intergenic
1030302182 7:107985471-107985493 AAAAATAAACTAGCTGGGCATGG + Intronic
1030728245 7:112952431-112952453 AAAGATAAATAACATTAGAAGGG + Intergenic
1031023674 7:116656277-116656299 TAGGAAAAACAACCTGAGGATGG - Intergenic
1031067764 7:117124691-117124713 AAAGTTAAACAACTTGCCCAAGG - Intronic
1032113524 7:129097519-129097541 AAAGATAATCAAGCCAAGCACGG + Intergenic
1032161780 7:129516497-129516519 AACAAAAAACAACCTGAGCCTGG + Intergenic
1032771498 7:135063382-135063404 AAAGAAGAACAAACTAAGCATGG - Intronic
1032815272 7:135467555-135467577 AAAAATAAATTAGCTGAGCATGG + Intronic
1033363188 7:140652360-140652382 AAAAAAAAAAAACCTGGGCACGG - Intronic
1034128221 7:148693090-148693112 AAAGAAAAAAAAGCTGGGCATGG + Intergenic
1034173601 7:149082871-149082893 AAAGATGAAGAGGCTGAGCATGG - Intronic
1034186084 7:149178295-149178317 AAAAAAAAATTACCTGAGCACGG + Intronic
1035158013 7:156929973-156929995 AAAGCTGAACAGCCTGAGGATGG + Intergenic
1035635795 8:1143280-1143302 AAACATAGACATCCTAAGCAGGG + Intergenic
1036580202 8:10066828-10066850 AAAGATATACCAGCTGAGCCAGG - Intronic
1036799316 8:11778281-11778303 AAAAAAAAAAAAACTGAGCAAGG - Intronic
1036982013 8:13480332-13480354 AAAGATAAAGAACATGGACATGG + Intronic
1037614408 8:20504596-20504618 AAAAATAAATTACCTGGGCATGG - Intergenic
1037849284 8:22313178-22313200 AAAGATGAACAGACAGAGCAAGG - Intronic
1038227179 8:25668267-25668289 AAAAGTAAACAACCAGAGCTGGG - Intergenic
1038711664 8:29952535-29952557 AAAAATAAATCACCTGAGCATGG + Intergenic
1038754728 8:30329971-30329993 ATAAATAAATAATCTGAGCATGG + Intergenic
1039052591 8:33508453-33508475 AAAGAAAAAGTAGCTGAGCATGG + Intronic
1039416993 8:37404121-37404143 AAAGGTAAACAACTTAAGGACGG + Intergenic
1039909256 8:41811120-41811142 ATAGAAAAACAAGCTAAGCATGG + Intronic
1040520437 8:48171866-48171888 AAAGAGAAACAAGCCAAGCATGG - Intergenic
1041235698 8:55799862-55799884 AAAGGAAACCAGCCTGAGCATGG - Intronic
1041995310 8:64049002-64049024 AAAAATCAACAATCTGTGCATGG + Intergenic
1042125100 8:65530324-65530346 AAAGTTAAAATAGCTGAGCATGG + Intergenic
1042151730 8:65794195-65794217 AAAGATAAATAAGATTAGCATGG + Intronic
1042323488 8:67503596-67503618 AAAGAAAATCAAGCTGGGCATGG - Intronic
1042619469 8:70689064-70689086 AAAGAAAAACAACATTAACAGGG + Intronic
1042913717 8:73853417-73853439 AAAAATAAACTAGCTGGGCATGG - Intronic
1043150259 8:76706078-76706100 AAGGAGAAACACCCTGAGCCGGG + Exonic
1043976751 8:86593295-86593317 GAAGATAAATAAACAGAGCATGG - Intronic
1044265537 8:90177174-90177196 AAAAAAAAAAACCCTGAGCAGGG - Intergenic
1044350659 8:91161695-91161717 AAAGATAAACAAAATCAACATGG - Intronic
1044810015 8:96050590-96050612 AAAGAAATACAAGCTGGGCATGG + Intergenic
1044824096 8:96179896-96179918 AAAAAAAAAAAAGCTGAGCATGG + Intergenic
1045358671 8:101412200-101412222 AAAGAAAACCTACCAGAGCAAGG + Intergenic
1045861692 8:106820724-106820746 ATAAATAAATAAGCTGAGCATGG - Intergenic
1046185060 8:110702678-110702700 AAAAAAAAAAAAACTGAGCAAGG + Intergenic
1046214271 8:111122520-111122542 AAAGATAAACAGAAAGAGCAAGG + Intergenic
1046531715 8:115454338-115454360 AAAGACAAACAATCATAGCATGG - Intronic
1047442325 8:124889104-124889126 CAAGATGAACAACCTCAGAAGGG + Intergenic
1048481149 8:134795014-134795036 AAAGATGAACAACTTGTTCAAGG + Intergenic
1048772634 8:137912087-137912109 AAAGAGAGACAACTTGTGCAGGG + Intergenic
1049677325 8:143896827-143896849 AAAGAAAAACAACCACATCATGG - Intergenic
1049851658 8:144835357-144835379 AAAGAAAAAACAGCTGAGCATGG - Intronic
1050440385 9:5655599-5655621 CAAGATAAAAACGCTGAGCAAGG - Intronic
1050579042 9:7031316-7031338 AAATACAAAAAACCTGGGCATGG - Intronic
1052236995 9:26222930-26222952 AAAGATAAAAATCCTTAGCTTGG + Intergenic
1052353962 9:27485236-27485258 ACAGATAAAGAAGCTGAGAAAGG + Intronic
1052920998 9:33969257-33969279 AAAGTTAAACAAACTAAGCTGGG + Intronic
1052929260 9:34042910-34042932 AAAGAAAAATTAGCTGAGCATGG + Intronic
1053587648 9:39477249-39477271 AAAGATAAACATACTGAGGCCGG - Intergenic
1054578651 9:66887990-66888012 AAAGATAAACATACTGAGGCCGG + Intronic
1055552380 9:77443824-77443846 AAAAATAAATTAGCTGAGCATGG + Intronic
1056225844 9:84494235-84494257 AAGGAAAAACAAGCTGTGCATGG + Intergenic
1056746457 9:89308096-89308118 AAAGATGCACAACCTGTACATGG + Intergenic
1057956721 9:99415379-99415401 GAAGAGAAACAACCTGCTCAGGG + Intergenic
1058043723 9:100333513-100333535 AAAGCAAAACAAGCTGGGCATGG + Intronic
1059233314 9:112741471-112741493 ATAGATATACACCCTGAGGAAGG - Intergenic
1060039192 9:120285094-120285116 CAAGATGAGCAACCTGAGAATGG + Intergenic
1060563461 9:124567883-124567905 AAAGAGAAACAGGCTGGGCACGG + Intronic
1060930834 9:127488550-127488572 AAAGCTAAACAGGCTGGGCACGG - Intronic
1060954549 9:127629266-127629288 AGAGATAAACGACCTTACCAAGG - Intronic
1060963385 9:127697503-127697525 AAACATAAATTAGCTGAGCATGG + Intronic
1061022471 9:128025206-128025228 AAAGAAAAACAGCCTGTGCAAGG - Intergenic
1061640874 9:131954092-131954114 AAAGATAAAAAGGCTGGGCATGG - Intronic
1062336585 9:136073272-136073294 AAAAATAAACTAGCTGGGCATGG + Intronic
1186010097 X:5120642-5120664 AAAGATAAAGAACTTGTCCAAGG + Intergenic
1187699563 X:21952096-21952118 ATAGATTAACAACCTGCCCAAGG - Intronic
1187868748 X:23747129-23747151 AAAGGTAAAAAAAATGAGCAGGG + Intronic
1188847767 X:35095092-35095114 AATGATAAGCAAGTTGAGCAAGG + Intergenic
1191650777 X:63535649-63535671 AAGGATTAATAACCAGAGCAAGG + Intergenic
1191733089 X:64358554-64358576 AAAGTTAAACAACTTGCCCAAGG + Intronic
1193839598 X:86393114-86393136 AAAGATTAACAAGGTGGGCAGGG - Intronic
1194168382 X:90551316-90551338 AAAGATAACCCACTTGATCATGG - Intergenic
1194640179 X:96394600-96394622 ATAGATACACAACCTGACCTTGG - Intergenic
1195097883 X:101523545-101523567 AAAGAAAAAATATCTGAGCAGGG + Intronic
1195483529 X:105375214-105375236 AAAGAACAACAATCTGAGCTGGG + Intronic
1195776750 X:108414634-108414656 AAAGAAGAAGAAGCTGAGCATGG + Intronic
1195963126 X:110405755-110405777 GAAGTTAGACAACCTGGGCAAGG + Intronic
1195963774 X:110411611-110411633 AAAATTTAACAACCTGAGTATGG + Intronic
1196295727 X:113994611-113994633 AAAGAAAAACAAGCGGAGAAAGG - Intergenic
1196435006 X:115666353-115666375 AAAGATAAACAAGCTAGGCGTGG + Intergenic
1196593317 X:117514138-117514160 AGACATAAACAAGCAGAGCATGG + Intergenic
1197022076 X:121703694-121703716 AAAGATTAACAACCTTCTCAAGG - Intergenic
1198396482 X:136224108-136224130 AAAGATAAACTGGCTGGGCATGG + Intronic
1198668465 X:139051344-139051366 TAGGATACACAACCTGATCAAGG - Intronic
1198772152 X:140141878-140141900 AAAGTTAAGCAACCTGTCCAGGG - Intergenic
1199027680 X:142959308-142959330 AAAAATAAAAAACCTTAGCCAGG - Intergenic
1199346903 X:146751749-146751771 AAAGATAAAAAATGTTAGCAAGG + Intergenic
1199676263 X:150191782-150191804 GAAGTTAAGCAACTTGAGCAAGG + Intergenic
1200011112 X:153121606-153121628 AAAAATAAACAAGCCTAGCAGGG + Intergenic
1200028487 X:153278316-153278338 AAAAATAAACAAGCCTAGCAGGG - Intergenic
1201534909 Y:15036459-15036481 AAAACTAAACATTCTGAGCATGG - Intergenic
1201590224 Y:15606522-15606544 AAAAAAAAAAAACCTGGGCATGG - Intergenic
1201852032 Y:18495603-18495625 AAAGATAAAGGAGCTGGGCATGG - Intergenic
1201881289 Y:18824777-18824799 AAAGATAAAGGAGCTGGGCATGG + Intronic