ID: 1155386311

View in Genome Browser
Species Human (GRCh38)
Location 18:25281909-25281931
Sequence GAATCCTGCTGGCCTAAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 99}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155386311 Original CRISPR GAATCCTGCTGGCCTAAAAC TGG Intronic
915854164 1:159363284-159363306 GAATCCTACAGGACAAAAACTGG + Intergenic
919012888 1:191988161-191988183 TGATCCTGCTGGTCAAAAACAGG + Intergenic
923020846 1:230162557-230162579 GAATCCCTCTTCCCTAAAACAGG + Intronic
1068378637 10:56217161-56217183 GAATCCTCCTGGGCTAAACCCGG + Intergenic
1071786348 10:88904419-88904441 GAAACATGCTGGTCTAAAGCAGG + Intronic
1072330951 10:94351268-94351290 GAATCCTGTTGGCCTAATAAGGG - Intronic
1080032062 11:27672215-27672237 GAATATTGCTGACCTAAATCTGG + Intronic
1085186454 11:74579943-74579965 GCACCCTGCTTGGCTAAAACTGG - Intronic
1086269985 11:85051218-85051240 CAATACTGCTGGACTGAAACTGG - Intronic
1087253958 11:95934634-95934656 TAATGCTGCTTGCCTAAGACAGG - Intergenic
1087499527 11:98932721-98932743 TAATGCTGCTTGCCTAAGACAGG + Intergenic
1089065066 11:115656478-115656500 GAATCCAGCTGCCCTAATAAAGG + Intergenic
1090543364 11:127733745-127733767 GAATGCTGCTGGACAAAGACAGG + Intergenic
1090714898 11:129422006-129422028 GAATCCTGATGGCCTATACTTGG + Intronic
1091365211 11:135013684-135013706 GAATGATGCTGGCCTCAAAATGG + Intergenic
1092135063 12:6141388-6141410 GAATCCTGCTGTGCTACTACTGG - Intergenic
1093771695 12:23025490-23025512 AAATCCTGCAGCCCTAAAACAGG - Intergenic
1095460883 12:42443259-42443281 TAATGCCGCTTGCCTAAAACAGG - Intronic
1095957284 12:47813948-47813970 GAGGCCTGCTGGCCTAGAGCCGG + Intronic
1108595452 13:51944970-51944992 GCAACCTGCTGGCCTTAAATGGG - Intronic
1110060128 13:71030213-71030235 TAATGCTGCTTGCCTAAGACAGG + Intergenic
1113135961 13:107089960-107089982 GAATCCTGCTGGCCAGAACTGGG - Intergenic
1115550211 14:34498264-34498286 GAACCCTGCTGGTCTCAAAAAGG + Intergenic
1115836371 14:37409137-37409159 GAATCCTGCTGGACTAAACTGGG - Intronic
1119034197 14:71215917-71215939 GAAACCTGCTGTGCTTAAACCGG + Intergenic
1119747281 14:77053298-77053320 GAAGCCTCCTGACATAAAACAGG + Intergenic
1126989650 15:54358741-54358763 TAATCATGCTGTCCTCAAACAGG + Intronic
1130948903 15:88570292-88570314 GAAGCCTGCTGGCCAATAAGAGG - Intergenic
1131901196 15:97089564-97089586 AAATCAAGCTGGCTTAAAACAGG + Intergenic
1133326889 16:4947350-4947372 GAATCCTGAGTGCCTAGAACAGG - Intronic
1137565840 16:49532016-49532038 GAATCCTGCTGTCCCGAAGCTGG + Intronic
1141581214 16:85000653-85000675 GTAACCTTCTGTCCTAAAACAGG - Intronic
1143671305 17:8397872-8397894 AAAGCCTCCTGGCCTCAAACGGG - Intergenic
1145768103 17:27473074-27473096 GAATCTTGCTGCCTTAAACCTGG - Intronic
1149307476 17:55363092-55363114 CAATCCAGCTGGGCTAAAGCTGG + Intergenic
1150615350 17:66766324-66766346 GAATCCTTCTGACCAGAAACAGG + Intronic
1153838562 18:8986269-8986291 CAAACCTGGTGGCTTAAAACAGG + Intergenic
1155386311 18:25281909-25281931 GAATCCTGCTGGCCTAAAACTGG + Intronic
1155721204 18:29014025-29014047 GAATCCTGCTTTCCTAAGGCAGG + Intergenic
1155751070 18:29422840-29422862 TAATGCTGCTTGCCTAAGACAGG + Intergenic
1157587207 18:48811048-48811070 GAATCCTTATGGCCTAAATTAGG + Intronic
1160131688 18:76231047-76231069 GAGTCCTGCTGTCCTAGGACAGG + Intergenic
1164056010 19:21622688-21622710 TAATGCTGCTTGCCTAAGACAGG - Intergenic
1164255823 19:23527367-23527389 TAATGCTGCTTGCCTAAGACAGG + Intronic
925241666 2:2336405-2336427 GAATAGTGCTGGTCTAAATCAGG + Intergenic
926132996 2:10317025-10317047 GAAGCCTGCTCGCCTATCACTGG + Intronic
927820143 2:26257434-26257456 TAATGCTGCTTGCCTAAGACAGG + Intronic
933111027 2:78400539-78400561 CAACCCTCCTGGCCTAAACCAGG + Intergenic
939427573 2:142059122-142059144 GATTCCTGCTTGCCTAAGATTGG + Intronic
940785053 2:157971999-157972021 GAAGCCTCCTGGCCAGAAACTGG - Intronic
942276201 2:174325927-174325949 GAATCCTGCTTACATAAAGCCGG + Intergenic
945572754 2:211490424-211490446 GAATGCTGCTGGCATTCAACAGG - Intronic
1170740518 20:19051867-19051889 CAAACCTGCAGGCCTAAATCAGG - Intergenic
1177396880 21:20548282-20548304 AAATCCTACTGGACTAAAAAGGG - Intergenic
1178975604 21:37218598-37218620 GAATCCTGCCGGCCTGGAGCGGG + Intergenic
1183983419 22:41555778-41555800 GAAGCCTGCTGGCCACAAAGAGG + Intergenic
1184762968 22:46555561-46555583 GAATCCTGAAGGCCTAAATTGGG - Intergenic
1184988562 22:48152753-48152775 GGACCCTGCAGGCCTGAAACTGG + Intergenic
1185412246 22:50688885-50688907 GAATCATTCTGGCCTAGAAGTGG - Intergenic
949737559 3:7191547-7191569 GAATACTGCTGGCAATAAACAGG + Intronic
955377468 3:58410237-58410259 GAGTTCTGCTGGCCAGAAACTGG + Intronic
956565806 3:70637392-70637414 GAATCCTGTTTGCCTTAAAAAGG - Intergenic
962026275 3:131551088-131551110 GGATCCCTCTGGCCAAAAACAGG - Intronic
973244246 4:47993399-47993421 GAACCCTGCTAGCTTAAATCAGG - Intronic
973782719 4:54304071-54304093 CAATCCTCGTGGCCTAAATCAGG + Intergenic
974640529 4:64624515-64624537 TAATGCTGCTTGCCTAAGACAGG + Intergenic
975468750 4:74739159-74739181 GAATGCTGCTGGTATAAATCAGG - Intergenic
979374997 4:119936061-119936083 AAATCCTACTGGCAGAAAACAGG - Intergenic
980238125 4:130134970-130134992 CAATCCTCCTGGCTTAAATCAGG + Intergenic
980628785 4:135407970-135407992 TAATGCTGCTTGCCTAAGACAGG - Intergenic
980981459 4:139657829-139657851 GAAACCTACTGGCCCCAAACAGG - Intergenic
981760523 4:148189751-148189773 CAATCCTCCTGGCTTAAATCTGG - Intronic
986066322 5:4237944-4237966 GAATACTGCTGTCGTAAAAATGG + Intergenic
993812578 5:92500677-92500699 GCAGCCTGGTGGCATAAAACTGG - Intergenic
996377452 5:122827872-122827894 GGTTTCTGATGGCCTAAAACTGG - Intronic
1003767111 6:9250831-9250853 GAGTCCTGCTTGCCAAAAATAGG + Intergenic
1005275499 6:24212324-24212346 GATACCTGCTGGGCAAAAACAGG + Intronic
1005481345 6:26258209-26258231 TAATGCTGCTTGCCTAAGACAGG - Intergenic
1007227332 6:40324403-40324425 TAAACCTGCTGGCCTCACACAGG - Intergenic
1011574544 6:88781239-88781261 GCATTTTGCTTGCCTAAAACAGG + Intronic
1011789442 6:90882518-90882540 CAATCCTCCTAGCCTAAATCAGG - Intergenic
1019393615 7:804292-804314 GAAAACTGCTGGCCCACAACAGG + Intergenic
1020906008 7:14065561-14065583 CTATCCCGCCGGCCTAAAACAGG + Intergenic
1023540112 7:41255789-41255811 CAATTCCGTTGGCCTAAAACAGG - Intergenic
1029889825 7:103915818-103915840 GAATCCTGCTGTAACAAAACAGG + Intronic
1032124795 7:129185581-129185603 GAATCCTGCTGGCCTAGCAAAGG - Intergenic
1032284742 7:130531738-130531760 GAATGCTCCAGGCCTGAAACTGG + Intronic
1032515189 7:132501647-132501669 AAACCCTGCTGGCCAAAAAGAGG + Intronic
1033806150 7:144956130-144956152 GAATGATGTTGGCCAAAAACAGG + Intergenic
1036107478 8:5856470-5856492 TAATGCTGCTTGCCTAAGACAGG + Intergenic
1038503740 8:28066786-28066808 GGATTCTGCTGGCATAAAAGAGG - Intronic
1039610176 8:38913401-38913423 GAATCCTGCAGGCTAAAAAGGGG + Intronic
1043603031 8:81963764-81963786 GAATCCAGCAGGGATAAAACAGG + Intergenic
1044408710 8:91860847-91860869 TCATCCTGCTGGCCTCACACTGG + Intergenic
1047710151 8:127543558-127543580 GAATTCAGCTGGTCTAACACAGG + Intergenic
1049709936 8:144058919-144058941 GGGTCCTGCTGGCCTTTAACGGG - Intronic
1051471430 9:17447264-17447286 CAATCCTGGTGCCATAAAACTGG + Intronic
1052312713 9:27085454-27085476 TAATAGTGCTGTCCTAAAACAGG + Intergenic
1058181376 9:101804545-101804567 GAGTCCTGGTAGCCTAAAAATGG - Intergenic
1060174887 9:121490427-121490449 GAATTCTGCTGGCCTAAGGAGGG - Intergenic
1062299503 9:135857143-135857165 GAATCCTGCTGGCCACCCACTGG + Intronic
1186583029 X:10841175-10841197 CAAACTTGGTGGCCTAAAACAGG - Intergenic
1187433914 X:19249469-19249491 GATTCCTGCTGGCAGAAAAGGGG + Intergenic
1188113559 X:26218847-26218869 TAATGCTGCTTGCCTAAGACAGG + Intergenic
1199677650 X:150201282-150201304 CTATCCTGCTGTCCTAATACTGG + Intergenic