ID: 1155386717

View in Genome Browser
Species Human (GRCh38)
Location 18:25285842-25285864
Sequence GTGGCAGTCCTGATACATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 85}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155386717_1155386726 23 Left 1155386717 18:25285842-25285864 CCTCCATGTATCAGGACTGCCAC 0: 1
1: 0
2: 0
3: 5
4: 85
Right 1155386726 18:25285888-25285910 TCTGAGGGTATAATGAGCAAAGG 0: 1
1: 0
2: 0
3: 10
4: 166
1155386717_1155386719 -7 Left 1155386717 18:25285842-25285864 CCTCCATGTATCAGGACTGCCAC 0: 1
1: 0
2: 0
3: 5
4: 85
Right 1155386719 18:25285858-25285880 CTGCCACCCTTTTGCTACACAGG 0: 1
1: 0
2: 1
3: 7
4: 137
1155386717_1155386724 8 Left 1155386717 18:25285842-25285864 CCTCCATGTATCAGGACTGCCAC 0: 1
1: 0
2: 0
3: 5
4: 85
Right 1155386724 18:25285873-25285895 TACACAGGCCAGAGCTCTGAGGG 0: 1
1: 0
2: 0
3: 17
4: 195
1155386717_1155386723 7 Left 1155386717 18:25285842-25285864 CCTCCATGTATCAGGACTGCCAC 0: 1
1: 0
2: 0
3: 5
4: 85
Right 1155386723 18:25285872-25285894 CTACACAGGCCAGAGCTCTGAGG 0: 1
1: 0
2: 1
3: 23
4: 231

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155386717 Original CRISPR GTGGCAGTCCTGATACATGG AGG (reversed) Intronic
909686136 1:78351094-78351116 TTAGCAGTCCTCATGCATGGTGG - Intronic
915773907 1:158461588-158461610 CTGGGAGTCCTGATAGATGGAGG + Intergenic
918414678 1:184294384-184294406 ATGGCAATCCTGGCACATGGAGG + Intergenic
924758704 1:246964927-246964949 GTGGCAGTACTGCAAGATGGGGG + Intronic
1063117040 10:3079031-3079053 GGGGCAGCCCAGCTACATGGGGG + Intronic
1070820355 10:79350642-79350664 GTGGAAGTCCTGAGCCAGGGTGG + Intronic
1072130247 10:92487140-92487162 GGGACAGACCTAATACATGGGGG - Intronic
1074379837 10:112970379-112970401 GTGGCCTTACTGATTCATGGTGG - Intronic
1076997802 11:307412-307434 GTTGCAGTCCTGCTCCATGCGGG - Intergenic
1078246656 11:9579199-9579221 GAGGCAGTCCTGTTTCATGCAGG - Intronic
1078528246 11:12117052-12117074 GTGGCTGTCCTGATACCTTGAGG + Intronic
1079368441 11:19829750-19829772 GTGCCTGTCCTGATCCATGCTGG - Intronic
1096078502 12:48818925-48818947 GTAGGAGTCGTCATACATGGGGG - Exonic
1098897487 12:76080789-76080811 GTGGCAGCACTGAGAGATGGGGG + Intronic
1102033688 12:109759146-109759168 GTGGCAGTCAGGAGACTTGGAGG - Intronic
1105255259 13:18740071-18740093 GTGCCATGCCTGACACATGGTGG + Intergenic
1105543933 13:21338352-21338374 TTGGGAGTCCTGACACCTGGTGG - Intergenic
1105704251 13:22959868-22959890 CTGGCCCTCCTGATTCATGGAGG - Intergenic
1105857202 13:24384920-24384942 CTGGCCCTCCTGATTCATGGAGG - Intergenic
1106342216 13:28841372-28841394 GTGGCAGTCATGGTAGTTGGAGG + Intronic
1110697414 13:78507653-78507675 GGGGTAGTGCTGATTCATGGCGG - Intergenic
1118141949 14:63093479-63093501 GGGGCAGTCCTGTGAAATGGAGG + Intronic
1122898494 14:104772226-104772248 GCTGCAGTCCTGGTACAAGGAGG - Intronic
1125854487 15:42935993-42936015 GTGGCAGTCTTGATGAGTGGAGG - Intergenic
1133736220 16:8617799-8617821 GTGTCTGTCCTGACGCATGGAGG + Intergenic
1134066445 16:11231578-11231600 GGGTCAGTCCTGAAACAAGGAGG - Intergenic
1139099175 16:63744564-63744586 GTGGCAGTGCTGGTGCAGGGCGG - Intergenic
1142343907 16:89541921-89541943 GTGGCCACCCTGATACATAGCGG + Intronic
1144689654 17:17252310-17252332 CTGGCAGTCCTGACATTTGGGGG + Intronic
1148545383 17:48514733-48514755 GTGGGAGTCATGATACAGGGAGG - Intergenic
1154435762 18:14340531-14340553 GTGCCATGCCTGACACATGGTGG - Intergenic
1155386717 18:25285842-25285864 GTGGCAGTCCTGATACATGGAGG - Intronic
1160153547 18:76413634-76413656 GTGGCAGCCCAGATATTTGGGGG - Intronic
1160460948 18:79037561-79037583 CTGGAAGGCCTGAGACATGGTGG - Intergenic
1161709477 19:5839800-5839822 AGGGCAGTCGTGATACTTGGAGG - Intergenic
1166112400 19:40630666-40630688 GCGGCAGTCCTGACAGCTGGAGG + Intergenic
925077794 2:1032971-1032993 GGGGCAGTCATGTCACATGGTGG + Intronic
925720512 2:6822194-6822216 GTGGGGGTCCTGCTTCATGGAGG - Intergenic
943352246 2:186809410-186809432 GTGGCTGTCCTGATAATTGAAGG - Intergenic
947046769 2:225995993-225996015 GTGACAGTCATGATTCATAGTGG + Intergenic
948878001 2:240840504-240840526 GGGGCAGTCGTGACCCATGGAGG + Intergenic
1176237437 20:64060221-64060243 TCTGCAGTCCTGATACTTGGAGG + Intronic
1176841274 21:13845103-13845125 GTGCCATGCCTGACACATGGTGG + Intergenic
1177517468 21:22174426-22174448 GGAGCAGGCATGATACATGGTGG - Intergenic
1181473413 22:23154381-23154403 GTGGAAGTCCTGAGAGAAGGGGG - Intronic
1184186393 22:42867943-42867965 GTGGCAGCACTGATCCAGGGTGG + Intronic
953135691 3:40179868-40179890 GTGTCCCTCTTGATACATGGAGG + Intronic
955058036 3:55473699-55473721 GTAGCAGGCCTGATGGATGGAGG - Intronic
956668631 3:71665074-71665096 GAGGCAGCCCTGATGCATGGTGG + Intergenic
960009288 3:112815911-112815933 GTTGCAGTCCAGAGACAAGGAGG + Exonic
971523539 4:27586157-27586179 CTTGCAGTCCTGTTACATTGTGG - Intergenic
975208927 4:71676683-71676705 CTGGCAGTGCTCATACAAGGTGG - Intergenic
978148775 4:105409603-105409625 CTGCCAGTCCGGCTACATGGGGG - Intronic
982757974 4:159247234-159247256 GGGACAGACCTGAAACATGGTGG - Intronic
986171215 5:5316323-5316345 TTGGAAGTCCTGGTGCATGGTGG - Intronic
986394882 5:7319086-7319108 GTGGCAGTGCTAAAGCATGGTGG - Intergenic
997475906 5:134142361-134142383 GTGGCAGTCCTCAGGCCTGGTGG - Intronic
999074492 5:148781388-148781410 GTGGCCAACCTGTTACATGGGGG + Intergenic
1000826220 5:166047702-166047724 GTGGCAATTCTGAAACATCGTGG - Intergenic
1003396152 6:5753825-5753847 GTGGCAGTCCAGCACCATGGTGG + Intronic
1003992097 6:11496410-11496432 TTGACAGCCCTCATACATGGAGG - Intergenic
1008441555 6:51537547-51537569 GTGGCAGTGCAGAAAGATGGAGG + Intergenic
1009472307 6:64042847-64042869 GTGGAAGTCCTTAAAGATGGTGG - Intronic
1014431947 6:121381445-121381467 GTGGCAGTGCAGAAAGATGGCGG - Intergenic
1014783636 6:125592970-125592992 GTGGCAGTCTTGAAAGGTGGGGG + Intergenic
1016275655 6:142349384-142349406 GGGGCATTCCAGCTACATGGGGG - Intronic
1017563411 6:155658155-155658177 GTGGCAGCCTTGATAGAAGGAGG + Intergenic
1018849657 6:167577925-167577947 GTGGCAGTGCTGATGGCTGGAGG - Intergenic
1018899998 6:168046304-168046326 GTGGTGGTCCTGACTCATGGCGG + Intergenic
1019038624 6:169084180-169084202 GTAGCAGCCCCGTTACATGGTGG - Intergenic
1019564407 7:1672265-1672287 GTGGCAGTCCTGGGGCATGGTGG - Intergenic
1022188687 7:27996050-27996072 GTGGCAATCCTGATGCTTGATGG - Intronic
1025730252 7:64101840-64101862 GTGCAAGTCCTGACACATAGCGG - Intronic
1027637148 7:80689691-80689713 GTCCCAGTCAGGATACATGGAGG - Intergenic
1028435939 7:90803651-90803673 GTGGCAGTTGTGTGACATGGTGG + Intronic
1030541712 7:110838448-110838470 ATGGCAGTACTGAAAGATGGGGG + Intronic
1031265783 7:119578314-119578336 GTGCCTGTCCAGATACAAGGAGG - Intergenic
1033257452 7:139814537-139814559 GTGGAAGGCCTCATACAAGGTGG + Intronic
1034849234 7:154478392-154478414 GTGGTAGTGGTGATAGATGGTGG - Intronic
1041429085 8:57758936-57758958 GGGGCAGTAATGATACAAGGTGG - Intergenic
1043549079 8:81348681-81348703 ATGGCAGGACTGATCCATGGTGG + Intergenic
1047126556 8:121968638-121968660 GTGCCATTCCAAATACATGGTGG + Intergenic
1052078636 9:24176150-24176172 GTGCTAGGCCTTATACATGGGGG - Intergenic
1056627436 9:88265107-88265129 GTGTTAGCCCTGCTACATGGTGG - Intergenic
1058433403 9:104939563-104939585 GAGGCAATTCTGATAGATGGAGG - Intergenic
1061884965 9:133586791-133586813 GTGGCAGTCCTGAGAAAGGCAGG - Intergenic
1062660785 9:137631548-137631570 GTGGCAGACCACATACATGAAGG + Intronic
1193659172 X:84236417-84236439 GTGGCAGGTGTGATGCATGGGGG + Intergenic
1195039237 X:100999096-100999118 GGGACATTCATGATACATGGAGG - Intergenic
1201464958 Y:14270261-14270283 TGGGAAGTCCTGAGACATGGTGG - Intergenic
1202027942 Y:20544004-20544026 GCAGCAGTCCTGCTACATGACGG - Intergenic