ID: 1155386718

View in Genome Browser
Species Human (GRCh38)
Location 18:25285845-25285867
Sequence AGGGTGGCAGTCCTGATACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 129}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155386718_1155386719 -10 Left 1155386718 18:25285845-25285867 CCATGTATCAGGACTGCCACCCT 0: 1
1: 0
2: 2
3: 12
4: 129
Right 1155386719 18:25285858-25285880 CTGCCACCCTTTTGCTACACAGG 0: 1
1: 0
2: 1
3: 7
4: 137
1155386718_1155386726 20 Left 1155386718 18:25285845-25285867 CCATGTATCAGGACTGCCACCCT 0: 1
1: 0
2: 2
3: 12
4: 129
Right 1155386726 18:25285888-25285910 TCTGAGGGTATAATGAGCAAAGG 0: 1
1: 0
2: 0
3: 10
4: 166
1155386718_1155386723 4 Left 1155386718 18:25285845-25285867 CCATGTATCAGGACTGCCACCCT 0: 1
1: 0
2: 2
3: 12
4: 129
Right 1155386723 18:25285872-25285894 CTACACAGGCCAGAGCTCTGAGG 0: 1
1: 0
2: 1
3: 23
4: 231
1155386718_1155386724 5 Left 1155386718 18:25285845-25285867 CCATGTATCAGGACTGCCACCCT 0: 1
1: 0
2: 2
3: 12
4: 129
Right 1155386724 18:25285873-25285895 TACACAGGCCAGAGCTCTGAGGG 0: 1
1: 0
2: 0
3: 17
4: 195

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155386718 Original CRISPR AGGGTGGCAGTCCTGATACA TGG (reversed) Intronic
900422236 1:2560642-2560664 CGGGGGGCAGTTCTGACACAGGG - Exonic
900495516 1:2974288-2974310 AGGGTGGCAGTCCTGGGACAGGG + Intergenic
902377523 1:16036813-16036835 TGGGTGACTGTCCTGACACAAGG + Intergenic
902382697 1:16060071-16060093 TGGGTGACTGTCCTGACACAAGG + Intronic
904520984 1:31095558-31095580 AGGGTGGCAGCCCAGAGCCATGG - Intergenic
907873680 1:58465916-58465938 AGGGAAGCAGTCCTGAGAAAAGG - Intronic
910693304 1:89986278-89986300 ACTGTGGCAGCCCTGATTCAGGG + Intergenic
912577498 1:110686753-110686775 AGGGCAGCAGTCCTGAAACCAGG + Intergenic
915645057 1:157264596-157264618 AGGGAGGCAGGTCAGATACAAGG + Intergenic
915773906 1:158461585-158461607 AAGCTGGGAGTCCTGATAGATGG + Intergenic
917666028 1:177226695-177226717 AGGGAAGCAGTCCTTATCCAAGG + Intronic
919427089 1:197446442-197446464 AGGGTGGCAGTGCTGAAAGATGG + Intronic
921973963 1:221180874-221180896 ATGGAGGAAATCCTGATACAGGG + Intergenic
1063805265 10:9631700-9631722 AGGATGGCACTTCTGATACTGGG - Intergenic
1064813017 10:19223269-19223291 CAAATGGCAGTCCTGATACAAGG - Intronic
1068831823 10:61504959-61504981 AGGGTGCCAGTCCTGAAACAGGG - Intergenic
1069658250 10:70106192-70106214 AGGGTGGCAGTGCTGCTGCTGGG - Intronic
1070916708 10:80159746-80159768 AGATTGGCAGTCCTGAGAAAGGG - Intronic
1076411738 10:130256385-130256407 TGGGTGTCATTCCAGATACATGG + Intergenic
1078528347 11:12117739-12117761 AGCCTGGCTGTCCTGATACATGG - Intronic
1080870215 11:36230212-36230234 AGGGTGACAGTCCAGAAACCAGG - Exonic
1081381577 11:42423064-42423086 AGGGTGCCAGTTCTGAGACTAGG + Intergenic
1083620500 11:64047090-64047112 AGGGTGGCCTTCCAGACACAGGG - Intronic
1083777562 11:64901771-64901793 AGGGAGGCAGCCCTGATGCTGGG - Intronic
1086750992 11:90493428-90493450 AGGGTGGCATCCCTGGTACTAGG + Intergenic
1087659541 11:100970753-100970775 AGGGAGGTAGTCCTGAAACGAGG + Intronic
1092229920 12:6770544-6770566 AGGGTGGCAGCTCTGGTGCAGGG - Exonic
1100270799 12:93022806-93022828 AGGGTGGCACAGCTGATAAAGGG + Intergenic
1104998646 12:132674648-132674670 GGTGTGACAGTCCTGATCCAAGG - Intronic
1105261190 13:18780557-18780579 AGGGTTGGAGTCCCCATACAGGG - Intergenic
1107446350 13:40473190-40473212 AGGGTTGCTGTCCTAATATATGG - Intergenic
1107639912 13:42431424-42431446 AGGGAGGAACTACTGATACATGG + Intergenic
1116509518 14:45726530-45726552 AGGTTGGCAGACCTGTTACCAGG + Intergenic
1118824413 14:69367349-69367371 AGGGTGGCAGCCCTCATGAATGG + Intergenic
1121703157 14:95971620-95971642 AGGCTGGCACTCCTGATGCAGGG - Intergenic
1121875406 14:97446761-97446783 CGGGTGAAATTCCTGATACAGGG + Intergenic
1122597435 14:102903127-102903149 CGGGTGGCAGGCCTCATACAGGG + Intronic
1202834921 14_GL000009v2_random:70889-70911 AGGGTTGGAGTCCCCATACAGGG + Intergenic
1125094660 15:35837509-35837531 AGGGTGGAAATCCTGCTACTGGG - Intergenic
1126437387 15:48649251-48649273 AAGGTGGCATTCCTTATTCAAGG + Intergenic
1128074571 15:64818220-64818242 GAGGTGGCAGTCCTGCTACGGGG - Intronic
1130250174 15:82294930-82294952 AGAGTGGCAGTGCTGAGACTGGG - Intergenic
1131390395 15:92043429-92043451 AGGCTGGCAGTCCTGACATCTGG - Intronic
1132689227 16:1175042-1175064 AGAGTAGGACTCCTGATACACGG - Intronic
1133118356 16:3590974-3590996 AGGGTGGCAGTCCGGTTTCTGGG - Exonic
1133428049 16:5710515-5710537 AGGATGGCAGGCCTGGCACATGG + Intergenic
1134117830 16:11562452-11562474 AAGGAGGCATTCCTGATCCATGG + Intronic
1134271186 16:12734812-12734834 GGGGTGCAAGTCCTGATTCATGG - Intronic
1134915227 16:18063734-18063756 AGGGTGGGAGCCTTGGTACATGG + Intergenic
1135066419 16:19314059-19314081 AGGTTGGCACTCCCGACACATGG - Intronic
1138915221 16:61455489-61455511 TGTGTGGCAGTCCTGTTACTGGG - Intergenic
1139513727 16:67441359-67441381 AGGCTGGCAGTCCTGGCACAAGG + Intronic
1142984714 17:3688940-3688962 AGGGAGGCAGCCCTGAGGCAGGG - Intronic
1143302602 17:5922076-5922098 GGGGTGGCAGTGCTTATGCAGGG + Intronic
1144513110 17:15894510-15894532 AGGGAGGCTGTGCTGATCCAGGG + Intergenic
1144690445 17:17258998-17259020 AGGTGGGCAGACCTCATACAAGG - Intronic
1148545384 17:48514736-48514758 ATAGTGGGAGTCATGATACAGGG - Intergenic
1148966617 17:51441253-51441275 AGGGTGGCAGTATTGAGAGATGG - Intergenic
1153109284 18:1564652-1564674 AGGGTAGCATTTCTGAGACAGGG + Intergenic
1153628086 18:7040817-7040839 AGGGTTGAAATACTGATACATGG + Intronic
1154424836 18:14264250-14264272 AGGGTTGGAGTCCCCATACAGGG + Intergenic
1154427517 18:14283583-14283605 AGGGTTGGAGTCCCCATACAGGG + Intergenic
1154430246 18:14303123-14303145 AGGGTTGAAGTCCCTATACAGGG + Intergenic
1154432521 18:14319473-14319495 AGGGTTGGAGTCCCCATACAGGG + Intergenic
1155185314 18:23382462-23382484 AGGGAAGCAGGCCTGAGACACGG + Intronic
1155386718 18:25285845-25285867 AGGGTGGCAGTCCTGATACATGG - Intronic
1157624642 18:49041127-49041149 ATGGTGGCAGTCCTGCTGCAAGG + Intergenic
1158642187 18:59213287-59213309 AGGGTGGGAGTCATGATTCGGGG + Intergenic
1162907097 19:13830584-13830606 AGGGTGGCTGTCCTGGTTGAAGG - Exonic
1165072672 19:33264602-33264624 AGGGTGGAAGCCCCGAGACAAGG - Intergenic
1167242026 19:48349769-48349791 AGGGTGGCTGTCATGATAAATGG - Intronic
1167671464 19:50856104-50856126 AGGCTGGGAGTCCTGGGACATGG - Intronic
1202637782 1_KI270706v1_random:56803-56825 AGGGTTGGAGTCCCCATACAGGG - Intergenic
925873107 2:8287707-8287729 AAGGTGGCACTCCTGACACAAGG + Intergenic
926445419 2:12935896-12935918 AGGGTGGGAGTCCAGAGCCAGGG + Intergenic
927827092 2:26316589-26316611 GAGGAGGCAGTCCTGATGCATGG - Intronic
934026428 2:88005322-88005344 AGGGTGACTGCCCTGATCCAGGG - Intergenic
937124280 2:119463459-119463481 AGGATGGCAGTGCGGAAACAGGG + Intronic
940023707 2:149182639-149182661 AGAGAGGCAGTGCTGATTCAAGG - Intronic
940883734 2:158970298-158970320 AGGCTGGCACTCCTGAGGCAGGG + Intronic
942418260 2:175781289-175781311 GGGGTGGCAGTCCTGATCCCAGG - Intergenic
945958105 2:216105175-216105197 AGCATGGCAGTCTTCATACATGG + Intergenic
947125765 2:226866671-226866693 AGAGAGGTAGTCCTGAAACAAGG + Intronic
948974952 2:241458289-241458311 AGGGAGTCAGTGCTGGTACAGGG + Intronic
1168811499 20:707692-707714 AGGGCGGCAGTCCTGGTCCCTGG + Intergenic
1170910715 20:20564757-20564779 TGGATGGCAGGCCTGATACTGGG - Intronic
1171884356 20:30640895-30640917 AGGGTTGGAGTCCCCATACAGGG - Intergenic
1172438990 20:34952186-34952208 AGGCTGGGAGTCCAGAGACATGG - Intronic
1175176334 20:57114721-57114743 AAGGTGGCAGTCCTGATCACAGG - Intergenic
1176844519 21:13866275-13866297 AGGGTTGGAGTCCCCATACAGGG - Intergenic
1176847247 21:13885838-13885860 AGGGTTGGAGTCCCCATACAGGG - Intergenic
1177517469 21:22174429-22174451 AGGGGAGCAGGCATGATACATGG - Intergenic
1181887281 22:26031354-26031376 AGGGTTGAAGTCCAGATTCAAGG + Intergenic
949292666 3:2484603-2484625 TGGGTGACAGTTCAGATACAAGG - Intronic
950196688 3:11014457-11014479 AGGTGGTCAGTCCTGATTCAAGG + Intronic
952189889 3:31011591-31011613 AGGGTGGCAGACCTGGAACCAGG - Intergenic
952873943 3:37926088-37926110 GGGCTGGCATTCCTGCTACATGG + Intronic
954162534 3:48733345-48733367 AAAGTGGAAGTTCTGATACAGGG + Intronic
960937526 3:122912856-122912878 GGGGTTGCAGTCCTGGTACTCGG + Exonic
962417107 3:135193179-135193201 AGGGTGGCTGTGCTGATGAAAGG - Intronic
973812584 4:54586195-54586217 AGCGTGTCAATCCTGATACTTGG + Intergenic
980129236 4:128803186-128803208 TAGGTGGAAGTCCTGGTACAGGG - Intergenic
984300178 4:177906554-177906576 AGAGAGGTAGTCCTGAAACAGGG + Intronic
985271565 4:188198421-188198443 AGGGTGGGGGTCCTGATGCATGG - Intergenic
1202765103 4_GL000008v2_random:142660-142682 AGGGTTGGAGTCCCCATACAGGG - Intergenic
986860756 5:11923909-11923931 AGCTTGGGACTCCTGATACAAGG + Intergenic
988071649 5:26297248-26297270 AGGGAGGCAGTCATGTTAGAGGG - Intergenic
994829914 5:104767374-104767396 AGGGAGGCAGTCTAGAAACATGG - Intergenic
997236468 5:132274889-132274911 AGGGTGCCAGTACTGAGACAGGG + Intronic
998879992 5:146635924-146635946 AGGTTGGCATTCGTCATACATGG - Intronic
999123515 5:149228940-149228962 AGGGCAGAAGTCCTCATACAAGG - Intronic
1000614786 5:163414720-163414742 AGGGTGGCAGTACTTATATGGGG - Intergenic
1000703302 5:164479741-164479763 AGGGAGACTGTCCTGATAAAAGG + Intergenic
1001316354 5:170643810-170643832 GGGGTGGCAGCCCTGACCCATGG - Intronic
1001860213 5:175047775-175047797 AGGGTGGCAGGACGGATGCAGGG + Intergenic
1004495947 6:16163044-16163066 AGGATGGCAGACCTGATAGGTGG + Intergenic
1005011517 6:21340324-21340346 AGTGTGCCAGTCCTGATTCTTGG + Intergenic
1006402711 6:33827048-33827070 CGGGTGGGAGGCCTGAGACAGGG - Intergenic
1008419964 6:51286870-51286892 AGGTTGGCAGTATTGATTCAAGG + Intergenic
1012944773 6:105453553-105453575 TGGGTGGCAGAGCTGAGACACGG - Intergenic
1013815678 6:114094705-114094727 AGGGTGGCTGTCATGATCCCTGG + Intronic
1017138314 6:151167612-151167634 AGGGTGAAAGTACTGAGACAAGG + Intergenic
1017635420 6:156438413-156438435 AGGGTGACAGACCTCATACATGG + Intergenic
1023575549 7:41622588-41622610 AGGGAGGCATTTCTGAGACAGGG - Intergenic
1024999347 7:55301998-55302020 AGGCTGTCAGTCTTGCTACATGG - Intergenic
1029352021 7:100020261-100020283 AGGATGGCAGTCAAAATACAAGG + Intronic
1034259316 7:149744908-149744930 CTCGTGGCAGTCCTGAGACAAGG + Intergenic
1034673347 7:152873168-152873190 AGGGTGGCAGTGAAGGTACATGG + Intergenic
1034923606 7:155103361-155103383 AGGGAGGCAGACCTATTACAGGG + Intergenic
1035152490 7:156886204-156886226 AAGGTGGCAATCCTGATAGCTGG + Intronic
1038415858 8:27395488-27395510 ACAGTGGCAGCCCTGCTACAGGG - Intronic
1042416692 8:68528212-68528234 AGGGTGGAATTCAAGATACATGG - Intronic
1047391776 8:124458199-124458221 AGGAATGCAGTACTGATACATGG + Intronic
1050816328 9:9817732-9817754 AGGATAACTGTCCTGATACAAGG + Intronic
1056404005 9:86257156-86257178 AGGGTTGCAGTCCTCAAACTTGG + Intronic
1057879371 9:98781668-98781690 AGGGTGGCAGTGCTGTGACGAGG + Intronic
1058649726 9:107163916-107163938 AGGGTGGCACTCTTCCTACAAGG + Intergenic
1061595205 9:131624491-131624513 TGGGTGGCGGTCCTCATGCAGGG - Intronic
1062509322 9:136896136-136896158 AGGGAAGCAGTCTTGATTCAGGG - Intronic
1203545851 Un_KI270743v1:127549-127571 AGGGTTGGAGTCCCCATACAGGG - Intergenic
1199343270 X:146707959-146707981 GGGGTGGGAGTCCTGATGAATGG + Intergenic
1199903168 X:152197689-152197711 AGAATGACAGTCATGATACATGG + Exonic
1201352145 Y:13055535-13055557 AGGTTGGTAGTCCTGTTACCAGG - Intergenic
1202134038 Y:21641972-21641994 ATTATGGCAGTCCTGACACAGGG - Intergenic