ID: 1155386719

View in Genome Browser
Species Human (GRCh38)
Location 18:25285858-25285880
Sequence CTGCCACCCTTTTGCTACAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 137}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155386714_1155386719 9 Left 1155386714 18:25285826-25285848 CCCAGGCTTGAAATTGCCTCCAT 0: 1
1: 0
2: 0
3: 11
4: 149
Right 1155386719 18:25285858-25285880 CTGCCACCCTTTTGCTACACAGG 0: 1
1: 0
2: 1
3: 7
4: 137
1155386717_1155386719 -7 Left 1155386717 18:25285842-25285864 CCTCCATGTATCAGGACTGCCAC 0: 1
1: 0
2: 0
3: 5
4: 85
Right 1155386719 18:25285858-25285880 CTGCCACCCTTTTGCTACACAGG 0: 1
1: 0
2: 1
3: 7
4: 137
1155386718_1155386719 -10 Left 1155386718 18:25285845-25285867 CCATGTATCAGGACTGCCACCCT 0: 1
1: 0
2: 2
3: 12
4: 129
Right 1155386719 18:25285858-25285880 CTGCCACCCTTTTGCTACACAGG 0: 1
1: 0
2: 1
3: 7
4: 137
1155386715_1155386719 8 Left 1155386715 18:25285827-25285849 CCAGGCTTGAAATTGCCTCCATG 0: 1
1: 0
2: 0
3: 16
4: 109
Right 1155386719 18:25285858-25285880 CTGCCACCCTTTTGCTACACAGG 0: 1
1: 0
2: 1
3: 7
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155386719 Original CRISPR CTGCCACCCTTTTGCTACAC AGG Intronic
901798688 1:11694697-11694719 CTGCCTCCCTCTTGCTCCGCTGG + Intronic
902662830 1:17917284-17917306 CTGCCACCCTCTGGCCACGCTGG + Intergenic
902875632 1:19339180-19339202 CTCCCACCTTTTTGGTACATTGG - Exonic
906679439 1:47715410-47715432 CTACCACCATTGAGCTACACAGG - Intergenic
912324204 1:108742531-108742553 CTGCCAGCCTGTTGCTAGAAGGG + Exonic
914879577 1:151537129-151537151 CAGCCACCCTTTTTGTACAAAGG - Intronic
918511255 1:185316666-185316688 CTGGAGCCCCTTTGCTACACTGG - Intronic
922337496 1:224629562-224629584 CTTCCACCTTTTGGCTACAGTGG + Intronic
923448685 1:234096320-234096342 CTCCCTCCGTTTGGCTACACAGG + Intronic
924380436 1:243458839-243458861 CTGCCACTGTTTTCCTACAAGGG + Intronic
1063020526 10:2122592-2122614 CTTCCACCCTGTGGCTGCACTGG + Intergenic
1065066818 10:21976769-21976791 CTGCCTTCCTTATGCTACAGAGG + Intronic
1066167813 10:32807627-32807649 CTCTCACCCTTTTCCCACACTGG - Intronic
1067011659 10:42720102-42720124 ATGCCACCCTTGTGCTGCAATGG - Intergenic
1070017333 10:72546507-72546529 CTTCCACCATGTGGCTACACTGG + Intronic
1073010286 10:100353821-100353843 CTTCCTTCCTTTTGCTCCACAGG - Intronic
1075535923 10:123272111-123272133 CTGCCTGCCTTTTGCTGCTCTGG + Intergenic
1077475585 11:2788856-2788878 CCGCCACCCTGTTCCTGCACAGG + Intronic
1079004563 11:16782754-16782776 CTGCCACCTGCTTGCTACGCTGG + Intronic
1079021606 11:16913473-16913495 CTGCCAGCCTTATGTTACCCTGG - Intronic
1084983728 11:72849051-72849073 CTGCCACCTTTTGGCTACACAGG + Intronic
1087810660 11:102606399-102606421 CTACCACCCTTCTGCTGCATAGG + Intronic
1089962583 11:122629031-122629053 CTGCCTCCCTCTTACTGCACAGG - Intergenic
1091714628 12:2768072-2768094 CTGCCTCCCATTTGCTTCTCTGG - Intergenic
1094461043 12:30696719-30696741 CTTCCACCCTTATGCTCCTCTGG - Intergenic
1097443146 12:59635710-59635732 CTGCCACCTCTGGGCTACACAGG - Intronic
1099509991 12:83523150-83523172 CTGCCAACCTCTTTCTACTCAGG - Intergenic
1102139192 12:110600619-110600641 CTGCCACCCTCTTTCTACATTGG + Intergenic
1107720368 13:43242237-43242259 CTGCCTCACATCTGCTACACAGG + Intronic
1107740620 13:43446243-43446265 CTGCCTCCCTTTTGGAACCCAGG + Intronic
1108351788 13:49594721-49594743 CTTCCATCCTTTTCCTCCACAGG + Intergenic
1110251631 13:73387078-73387100 CTCCCTCCCTGTTGCTACAAAGG - Intergenic
1111433736 13:88179292-88179314 CTTCCACCATGTGGCTACACTGG + Intergenic
1116012533 14:39367565-39367587 CCCTCACCCTTTTCCTACACTGG + Intronic
1118110855 14:62717961-62717983 CTGCCTCCATATTGCTGCACAGG - Intronic
1118625200 14:67652472-67652494 CTACCACCCTTTAGATGCACTGG + Intronic
1121124097 14:91394938-91394960 CTGCCACCCCTCTGCCAGACGGG + Intronic
1126061783 15:44789839-44789861 CTGCCAGCCTTTTCCTACCTTGG - Intergenic
1126496481 15:49296425-49296447 CTGCATCCATGTTGCTACACAGG + Intronic
1127270512 15:57397172-57397194 CTTCCTCCCTGTGGCTACACAGG - Intronic
1129775238 15:78232495-78232517 CTGCCACCCCTTTTCACCACAGG + Intronic
1131771102 15:95737997-95738019 CTGCAACCCTTTAGTTAGACAGG + Intergenic
1133339823 16:5028909-5028931 CTGCCACCTTTGTGCTCAACGGG - Exonic
1133433473 16:5758855-5758877 CAGCCACGCTTTTGCCACAGTGG - Intergenic
1139487072 16:67263953-67263975 CTGCCCCCTTCTAGCTACACAGG - Intronic
1141815662 16:86407956-86407978 CTGCCACACTTTTCATACAAGGG - Intergenic
1142008419 16:87701299-87701321 CTGCTACCCTCTTGCTAACCTGG - Intronic
1144604242 17:16650525-16650547 CTGCCACCCTGTTGCTCCATAGG - Intronic
1145199471 17:20929650-20929672 GTGCCAACATTTGGCTACACAGG + Intergenic
1146152016 17:30481541-30481563 CAGCCACCTTTTCCCTACACTGG - Intronic
1146175277 17:30662259-30662281 CTGCAACCCTCTTAATACACAGG + Intergenic
1146348729 17:32078301-32078323 CTGCAACCCTCTTAATACACAGG + Intergenic
1146953698 17:36923565-36923587 CTCTCTCCCTTTAGCTACACTGG - Intergenic
1148258854 17:46161539-46161561 CTGCCACCCTGTTTCTTCCCAGG + Intronic
1151222088 17:72620611-72620633 CTCCCACCCTTTTGGAACCCTGG - Intergenic
1151561456 17:74872107-74872129 CTGCCACCATTTCTCCACACAGG - Exonic
1153037225 18:774911-774933 TTGCCTCACTTCTGCTACACTGG + Intronic
1155386719 18:25285858-25285880 CTGCCACCCTTTTGCTACACAGG + Intronic
1158762631 18:60408648-60408670 CTACATCCCTTTTGCTACAAAGG - Intergenic
1158892925 18:61889795-61889817 TTGCCACTCTTTTTCTACCCTGG + Intronic
1161464345 19:4419892-4419914 CTCCCACCCTGTTGCTAAGCAGG - Intronic
1162983684 19:14255672-14255694 CTGCAACCCTCTTAATACACAGG - Intergenic
1165730902 19:38143961-38143983 GTGCCACACTTTAGCCACACTGG + Intronic
1168187444 19:54709106-54709128 ATCCCACCCTTGAGCTACACTGG - Intergenic
925559117 2:5168831-5168853 CTGCCCTGCTTCTGCTACACTGG - Intergenic
925812447 2:7713598-7713620 CTTCCACCACTTGGCTACACTGG + Intergenic
929554650 2:42918221-42918243 CACCCACCCCTTTGATACACTGG - Intergenic
931260975 2:60619022-60619044 CTGCCACCTGTTTTCTACAGCGG + Intergenic
933141877 2:78801451-78801473 CTGCAACCATGTTGCTACAAAGG - Intergenic
933515948 2:83301928-83301950 CTGCATCCATTTTGCTACAAAGG + Intergenic
933691343 2:85181604-85181626 CAGCCAGCCTTTTGCTCCCCTGG - Intronic
933708016 2:85305794-85305816 CTGCCATCTTTATGGTACACGGG - Intronic
934961126 2:98674651-98674673 CTGCCCCACTTTTCCTACAGAGG - Intronic
935483604 2:103624115-103624137 CTTCCACCTTTTTGTTACATTGG + Intergenic
936466987 2:112762559-112762581 CTGCCGCTCTTCTGCAACACAGG + Exonic
936488324 2:112946580-112946602 CTCCCTCCCTCTTGCTACACTGG + Intergenic
937171935 2:119881039-119881061 CTGCCACCCCTATACAACACAGG + Intronic
940287883 2:152050245-152050267 CTTCCATCCTTTTGGCACACTGG + Intronic
941253501 2:163198126-163198148 ATTCCACCCTTTTGTTACAGGGG + Intergenic
941469645 2:165868771-165868793 ATGCCACCATTTTTCTACTCAGG + Intronic
942237575 2:173927059-173927081 TTGCCACCCTCTTGCTGCCCTGG - Intronic
948015683 2:234688826-234688848 CAGCCACACTTTTACAACACAGG - Intergenic
1170034127 20:11972243-11972265 CTGCCAACCTCTTGAGACACTGG - Intergenic
1171150833 20:22825252-22825274 CTGCATCCATGTTGCTACACAGG + Intergenic
1171467098 20:25337316-25337338 CTTCCACCTGTTTGCCACACTGG - Intronic
1172719460 20:36988411-36988433 CTGACACCCTCTTCCAACACTGG - Intergenic
1175297851 20:57921559-57921581 CCCCCACACTTTTGTTACACTGG - Intergenic
1177649339 21:23940375-23940397 CTGCAGCCCTTTGGCTACAGAGG + Intergenic
1178619098 21:34158626-34158648 CTGCCACCCTTTTCCCTCCCAGG - Intergenic
1178839330 21:36126250-36126272 CTGCCACACCCTTGCTAAACTGG - Intergenic
1180253167 21:46603342-46603364 GAGCCACCCTTTCGGTACACTGG - Intronic
1181306396 22:21919701-21919723 CTGCCCCCCTTGAGCTACAGAGG + Exonic
1184465260 22:44665234-44665256 CTGCCAGGCTTTAGCTCCACTGG - Intergenic
1185004492 22:48267775-48267797 CTGCCATCCTTTTCCTAGAACGG + Intergenic
949592714 3:5510567-5510589 CTGCCACCCTTCTACAACCCAGG - Intergenic
949679827 3:6500091-6500113 CTGCAACCACTTTCCTACACTGG + Intergenic
955743286 3:62115010-62115032 CTGACACTGTTTTGCTAAACTGG + Intronic
956860301 3:73316689-73316711 CTGGCACCCCTATGGTACACAGG + Intergenic
957288594 3:78248717-78248739 CTGCCTCCCTTTTTCTAGATAGG + Intergenic
961966376 3:130908505-130908527 CTGCCAGCCATTTTCTATACAGG - Intronic
963961320 3:151312431-151312453 CTGCTGCCCTTTTGGTATACTGG + Intronic
964384285 3:156130814-156130836 CTCCCAGCCTTTTGATAGACAGG - Intronic
968863915 4:3195498-3195520 GTGCCACCCTTGTGATCCACAGG + Intronic
969704539 4:8784655-8784677 CTGCCACCCTTGTGGGTCACCGG - Intergenic
971765296 4:30823137-30823159 TTGGCACCCTTTTGCTTCGCAGG + Intronic
972698256 4:41468799-41468821 CTGCCACCCACCAGCTACACTGG - Intronic
975763564 4:77642149-77642171 CTTCCTTCCTTTTCCTACACAGG + Intergenic
976404771 4:84650926-84650948 CTGCCACCACATTGCTACATTGG - Exonic
976607775 4:86998527-86998549 CTGCTAGCATTTTGCTACAGAGG + Intronic
978799507 4:112741484-112741506 CTGCCACCCTATCGCTAAAGAGG - Intergenic
981354269 4:143769120-143769142 CTGCCACCATGTTGCTGCAAAGG + Intergenic
983922439 4:173360289-173360311 CTGGGAGCCTTTAGCTACACTGG - Intergenic
984380209 4:178983126-178983148 CAGCCAACCTATTTCTACACAGG + Intergenic
986031029 5:3892693-3892715 CTGCCAAGCTTTTGACACACAGG - Intergenic
986957340 5:13169333-13169355 CTGGCACCCTTTTTCTGCATAGG + Intergenic
997405734 5:133645173-133645195 CTGCCATTCTTTTGCTTCAGGGG + Intergenic
998870404 5:146545966-146545988 GTGCCACCATTTTGCTAGACAGG + Intergenic
998979917 5:147690879-147690901 CTGAGACCCTTTGGGTACACAGG + Intronic
1001756926 5:174177607-174177629 CTGCCACCTTTTCTCTACCCAGG + Intronic
1001878016 5:175217735-175217757 CTGCCATTCTTTTGGTGCACAGG - Intergenic
1005083671 6:21981773-21981795 CTGCCTCCTCTTTGCTACTCTGG + Intergenic
1008587596 6:52963407-52963429 CAGCCCCACTTTTGCTAGACAGG + Intergenic
1011314514 6:86016728-86016750 CTCCAAACCTTTTGCTACAGCGG - Intergenic
1013680285 6:112517817-112517839 CTTCCACCCTGTAGCTGCACTGG - Intergenic
1013833530 6:114303334-114303356 CTGCCACATTTTAGCTTCACTGG + Intronic
1016737473 6:147494904-147494926 ATTCCACCCCTTTGGTACACTGG + Intergenic
1018252067 6:161881309-161881331 CTGCCACCCTTTTTCTTTGCGGG + Intronic
1019123067 6:169820511-169820533 AGGCCACCCTTTTGCTAGCCAGG + Intergenic
1019363424 7:617730-617752 CTGCCACCCCTTGGGTTCACAGG - Intronic
1021589706 7:22247815-22247837 CTGCAACCATATTGCTACAAAGG - Intronic
1033438481 7:141356013-141356035 CTGCAACCATGTTGCTACAAAGG + Intronic
1033627586 7:143125678-143125700 CTGCCACCCTTTCCCTAAACTGG + Intergenic
1035277127 7:157754326-157754348 CTGCCACTGCTTTGCTAGACAGG - Intronic
1036626622 8:10478063-10478085 TTGCCTCCCTTTTGTTACAGAGG + Intergenic
1038444773 8:27595781-27595803 CTCCCACCCCTTTCCTACTCTGG + Intergenic
1038966348 8:32577121-32577143 CTGCATCCCTGTTGCTACACAGG + Intronic
1041592206 8:59601278-59601300 ACGCCACTCTTTTGCTTCACTGG - Intergenic
1042734260 8:71969916-71969938 CTGGAACCATTTTGCTACAAAGG + Intronic
1049341509 8:142115013-142115035 CTCCCACCCTGTTGCTTCCCAGG + Intergenic
1049345775 8:142137802-142137824 CCGCCACCCCTTTGCTGCACTGG - Intergenic
1052405219 9:28051087-28051109 CTGCTTTCCTTTTCCTACACAGG + Intronic
1058172939 9:101704964-101704986 CTGCCTCCCTTTTGAGACTCAGG - Intronic
1188001446 X:24986280-24986302 CTGCCACCCATTACCTCCACTGG + Intronic
1192289556 X:69779097-69779119 CTGCCAAACTGTTTCTACACTGG - Intronic
1194451516 X:94049660-94049682 ATGCCACCTTTTTGCTAGCCAGG - Intergenic
1196095174 X:111791182-111791204 CTTCCATCCTTTTCCTCCACAGG + Intronic