ID: 1155386723

View in Genome Browser
Species Human (GRCh38)
Location 18:25285872-25285894
Sequence CTACACAGGCCAGAGCTCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 256
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 231}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155386714_1155386723 23 Left 1155386714 18:25285826-25285848 CCCAGGCTTGAAATTGCCTCCAT 0: 1
1: 0
2: 0
3: 11
4: 149
Right 1155386723 18:25285872-25285894 CTACACAGGCCAGAGCTCTGAGG 0: 1
1: 0
2: 1
3: 23
4: 231
1155386715_1155386723 22 Left 1155386715 18:25285827-25285849 CCAGGCTTGAAATTGCCTCCATG 0: 1
1: 0
2: 0
3: 16
4: 109
Right 1155386723 18:25285872-25285894 CTACACAGGCCAGAGCTCTGAGG 0: 1
1: 0
2: 1
3: 23
4: 231
1155386717_1155386723 7 Left 1155386717 18:25285842-25285864 CCTCCATGTATCAGGACTGCCAC 0: 1
1: 0
2: 0
3: 5
4: 85
Right 1155386723 18:25285872-25285894 CTACACAGGCCAGAGCTCTGAGG 0: 1
1: 0
2: 1
3: 23
4: 231
1155386718_1155386723 4 Left 1155386718 18:25285845-25285867 CCATGTATCAGGACTGCCACCCT 0: 1
1: 0
2: 2
3: 12
4: 129
Right 1155386723 18:25285872-25285894 CTACACAGGCCAGAGCTCTGAGG 0: 1
1: 0
2: 1
3: 23
4: 231

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155386723 Original CRISPR CTACACAGGCCAGAGCTCTG AGG Intronic
901018621 1:6245104-6245126 GGGCACAGGCCAGAGCCCTGTGG - Exonic
901251467 1:7783588-7783610 CGGCTCAGGCCAGCGCTCTGGGG - Intergenic
903358028 1:22760037-22760059 CTATAGAGGCCAAACCTCTGAGG + Intronic
903661588 1:24981875-24981897 CTCCACAGGCCTGAGCCCAGCGG + Intergenic
905887050 1:41496992-41497014 TTACACAGCCCAGGACTCTGGGG - Intergenic
906158283 1:43627278-43627300 CTGCTCAGGCCAGAACTGTGGGG - Intergenic
907287868 1:53393525-53393547 CCAGGCAGGCCTGAGCTCTGGGG - Intergenic
907519968 1:55016972-55016994 CTACAAAGGAGAGAGATCTGTGG - Intergenic
908474983 1:64478612-64478634 CTGGATAGGACAGAGCTCTGGGG - Intronic
912253787 1:108038462-108038484 CAGCCCAGGCCAGAGCTTTGAGG + Intergenic
915023579 1:152805189-152805211 CTGCAGCAGCCAGAGCTCTGGGG + Exonic
915024287 1:152812714-152812736 CTGCAGCAGCCAGAGCTCTGGGG - Exonic
915697294 1:157756637-157756659 CTACTCAGGCCAGAGTGCAGTGG - Intronic
920410275 1:205753926-205753948 GTACACAGGGCAGATCACTGGGG - Intergenic
920712213 1:208306151-208306173 CAGCACATGCGAGAGCTCTGGGG + Intergenic
921003204 1:211066017-211066039 CTGCCCAGGCTAGAGCTCAGTGG - Intronic
921578981 1:216873775-216873797 CTACAGGGGCCAGATGTCTGAGG - Intronic
922564228 1:226590736-226590758 GTGCACAGTCCAGAGCTCAGTGG - Intronic
1062808442 10:443054-443076 CCACACAGGACAGACTTCTGCGG - Intronic
1064061540 10:12141774-12141796 ATACACAGGACAGACCCCTGGGG - Intronic
1065125350 10:22568629-22568651 CTAGACAACCCAGAGCTCTAAGG - Intronic
1065321072 10:24510649-24510671 CTTCAAAGGCAGGAGCTCTGTGG + Intronic
1065522760 10:26588396-26588418 CTCCCCAGGCCACAGCTCTCAGG + Intergenic
1065558217 10:26937323-26937345 CTCCCCAGGCCACAGCTCTCAGG - Intergenic
1068122122 10:52791845-52791867 CAACACAGGCTTGAGCTGTGTGG - Intergenic
1070825968 10:79390857-79390879 CCACACAGGTCAGGGCTCTGTGG + Intronic
1071455374 10:85845981-85846003 GTGCACAGGGGAGAGCTCTGAGG + Intronic
1071492170 10:86143525-86143547 GGACAAAGTCCAGAGCTCTGTGG - Intronic
1071918152 10:90319397-90319419 CTGCACTGGCCAAGGCTCTGGGG + Intergenic
1073176408 10:101560089-101560111 CAAGACTGGCCAGAGCTGTGGGG - Intergenic
1073309811 10:102532319-102532341 CCACACAGGCCAGCCCTCTAGGG + Intronic
1073616192 10:104998691-104998713 CTAGAAAGGCCAGAGGTCTCAGG + Intronic
1074437082 10:113443424-113443446 CCACACTGCCCAGAGCTGTGGGG + Intergenic
1074535367 10:114325028-114325050 CCACACAGGACTGGGCTCTGGGG - Intronic
1076208485 10:128622474-128622496 CTACACAGGCCAGGGTTCAGGGG - Intergenic
1076850786 10:133091727-133091749 CTACACACACCAGGTCTCTGGGG - Intronic
1077008784 11:370892-370914 CCACACAGGCCAAGGGTCTGGGG + Intronic
1078646901 11:13148989-13149011 CTAGGCAGGCCAGAGCACAGTGG - Intergenic
1080797716 11:35580889-35580911 CTCCACAGGGCAGCTCTCTGTGG - Intergenic
1082201016 11:49367505-49367527 CTTCATAGGCAAGGGCTCTGAGG + Intergenic
1082896082 11:58191276-58191298 CAACACAGGCCAGTCCTCCGAGG + Exonic
1083161009 11:60854141-60854163 CTTCACCCGCCAGTGCTCTGGGG - Intronic
1083192971 11:61065888-61065910 CTACGCAGGCCAGACATCTGGGG - Intergenic
1083360481 11:62104000-62104022 GTACACAGGGCAGAGGTCTCTGG + Intergenic
1084700815 11:70785204-70785226 CCACACAGGACAGACCCCTGGGG + Intronic
1084744473 11:71160012-71160034 CAACATAGGACAGAGCGCTGTGG + Intronic
1085328086 11:75623961-75623983 CTGCGGTGGCCAGAGCTCTGGGG + Intronic
1085655599 11:78311867-78311889 ATACAGAGGCCAGAGCCCTGAGG + Intronic
1085708968 11:78812125-78812147 CTACAAGGGCGAGAGCTGTGAGG - Exonic
1086456038 11:86959463-86959485 CTTGACATGCAAGAGCTCTGTGG - Intergenic
1086654660 11:89338700-89338722 CTTCATAGGCAAGGGCTCTGAGG - Intronic
1089117050 11:116103821-116103843 CTACACAAGCATGAGCTCTTGGG - Intergenic
1089650111 11:119907468-119907490 CAGTCCAGGCCAGAGCTCTGGGG - Intergenic
1090563271 11:127957272-127957294 CAACATAGTCCATAGCTCTGAGG + Intergenic
1091391652 12:129720-129742 CTGCTCAGGCCAGAGGGCTGTGG + Intronic
1091689438 12:2585557-2585579 CTTCCCAGGCCAGAACCCTGTGG + Intronic
1091976224 12:4827723-4827745 CTTCCCAGGGCAGAGCTGTGAGG - Intronic
1092060210 12:5544211-5544233 CTATACAGGAAAGAGCTGTGAGG + Intronic
1092117962 12:6022884-6022906 CTACACAGCCCAGAGCTGCGAGG - Exonic
1092283146 12:7112639-7112661 CTACATAAGCCAAAGCTCTCTGG + Intergenic
1093212977 12:16329255-16329277 CAACACTGGCCAGAGCTCTGTGG - Intergenic
1095702866 12:45208501-45208523 ATACAAAGGCCAGAGCCTTGAGG - Intergenic
1095991408 12:48037068-48037090 CTACCAGGGCCAGAGCTGTGGGG + Intergenic
1098284282 12:68892463-68892485 CTCCACATTCCACAGCTCTGGGG - Intronic
1100577867 12:95908780-95908802 CTACACATACCAAAGCTCTTAGG + Intronic
1101441084 12:104704719-104704741 CTCCAAAGGCCAGGGTTCTGGGG - Intronic
1102475860 12:113187930-113187952 ATAAACAGGACAGAGCCCTGTGG - Intronic
1104573896 12:129949222-129949244 CTCCACAGGCTGGAGCTCAGTGG - Intergenic
1105750047 13:23414629-23414651 CTAAACAGCATAGAGCTCTGTGG + Intronic
1106183500 13:27387914-27387936 CTACACAGGCCTCAGGTTTGTGG + Intergenic
1106654439 13:31727146-31727168 CTACAGGGGCCAGTCCTCTGTGG + Intergenic
1108788683 13:53939673-53939695 CTACACAGGACTGAGGTCTTCGG + Intergenic
1112761773 13:102699819-102699841 CTGCACTGGCCAGACTTCTGGGG + Intergenic
1113869790 13:113552180-113552202 CCACCCAGGTCAGTGCTCTGGGG - Intronic
1117333307 14:54735595-54735617 CCACAGAGGCCTGAGCTCCGTGG + Intronic
1118601809 14:67475927-67475949 TTGCACAGGCCAGTGCTTTGTGG + Intronic
1118823569 14:69360946-69360968 CATCACTGCCCAGAGCTCTGTGG - Intergenic
1119612249 14:76073439-76073461 CTACATAGGGCAGAAATCTGGGG + Intronic
1119936488 14:78596840-78596862 CCACCCCTGCCAGAGCTCTGAGG + Intronic
1120536442 14:85701768-85701790 CTCAACAGGTGAGAGCTCTGAGG - Intergenic
1120980707 14:90286667-90286689 AGGCACAGGCCAGAGTTCTGTGG + Intronic
1121026559 14:90620606-90620628 CTGCACAGGCTGGAGCTCTCTGG + Intronic
1121081841 14:91114725-91114747 GCACACAGGCCAGAGCTTCGTGG + Intronic
1124887767 15:33702743-33702765 ATAGCCAGGCCAGAGCCCTGAGG + Intronic
1127146945 15:56034694-56034716 TCACACAAACCAGAGCTCTGAGG - Intergenic
1128106833 15:65051482-65051504 ACACACAGGACAGAGCCCTGAGG - Intronic
1129652548 15:77501521-77501543 CAACCCAGGTCGGAGCTCTGAGG - Intergenic
1130336448 15:82960940-82960962 CAGCACAGGCCAGGGCTTTGTGG - Intronic
1135843540 16:25897580-25897602 GTAAAGAGGCCAGAGCTCAGAGG - Intronic
1136047508 16:27626141-27626163 ATACAGAGGCCAGAGCACAGTGG - Intronic
1136071672 16:27791270-27791292 GCACACAGGCCAGGGTTCTGGGG + Exonic
1136231730 16:28889667-28889689 CTTCACAGGCAGAAGCTCTGGGG - Intronic
1137469998 16:48745632-48745654 CTGCATAGGTCAGAACTCTGTGG + Intergenic
1141140397 16:81493314-81493336 GTGCACAGGCCGGAGCTCTGGGG + Intronic
1142115704 16:88355063-88355085 CTCCCCAGGCCCGAGGTCTGTGG - Intergenic
1142425643 16:90000920-90000942 CCACAGGGGCCAGAGCCCTGGGG - Intergenic
1142851149 17:2705369-2705391 CTTCTCAGGCCAGCGCTCTCAGG + Intronic
1143565934 17:7720582-7720604 CTACACTGACCAGTGCTCTCAGG - Intronic
1144049385 17:11485558-11485580 CTACGTTGGCCAGAGCTCTGGGG - Intronic
1144946574 17:18972416-18972438 ATTCATAGGCCAGAGCACTGAGG + Intronic
1145207767 17:20993817-20993839 CTGCCCAGGCCAGTGATCTGAGG - Intergenic
1146301568 17:31693713-31693735 CTATACAGCCCCAAGCTCTGGGG - Intergenic
1146711202 17:35042979-35043001 TTTCACAGGCCAGAACTCAGGGG + Intronic
1148850894 17:50554546-50554568 ACACACAGACCTGAGCTCTGGGG - Intronic
1149702894 17:58670039-58670061 CTACACAGGCAAAGGCTCTGAGG - Intronic
1150491896 17:65580032-65580054 CTACCCAGGCCAGAGTGCAGTGG - Intronic
1151983394 17:77527469-77527491 GTAAACATGCCAGTGCTCTGAGG - Intergenic
1152423774 17:80208115-80208137 CTGCACAGGCCAGAGTTGGGGGG - Intronic
1152462657 17:80449641-80449663 CGTCACATGCCAGAGATCTGGGG + Intergenic
1154309447 18:13255732-13255754 CTCCCCAGGCCAGGGCTGTGGGG + Intronic
1154325814 18:13389655-13389677 CCACAGAGGCCAGGGTTCTGGGG + Intronic
1154473257 18:14725261-14725283 TCACACAGGCCAGAGTTCAGTGG + Intergenic
1155240097 18:23856693-23856715 CTGCAAGGGCCAGAGCTCAGAGG - Intronic
1155386723 18:25285872-25285894 CTACACAGGCCAGAGCTCTGAGG + Intronic
1156686058 18:39648180-39648202 CTACACAAGAGAGAACTCTGAGG - Intergenic
1157748879 18:50160830-50160852 CTACACAGTTCAGAACTGTGTGG + Intronic
1157815244 18:50725313-50725335 CTCCACAGCCCAGAGCTCCTGGG - Intronic
1160399989 18:78603225-78603247 CTACAGAGGCCAGCGATCTGTGG - Intergenic
1161253692 19:3294886-3294908 CCACAAAGGCCAGAGTTCAGAGG - Intronic
1161356695 19:3823103-3823125 CTGCACAGGCCAGACCTCCATGG - Intronic
1162139312 19:8576480-8576502 CTACACAGCAGAGAGCTGTGGGG + Intronic
1164645291 19:29854886-29854908 CTGGACAGGAAAGAGCTCTGGGG - Intergenic
1165557450 19:36646934-36646956 CTACATATGCAAGAGCTCTTGGG + Intronic
1165824393 19:38697624-38697646 CCACACAGGCCAAGGCTGTGAGG + Intronic
1166332915 19:42089032-42089054 CTGCCCAGGCCAAAGCCCTGCGG + Intronic
1166878709 19:45914066-45914088 GCCCACAGGCCAGAGCTCCGAGG + Exonic
1167093232 19:47359062-47359084 GTCTACAGGCCAGAGATCTGAGG + Intronic
1167250313 19:48395717-48395739 CTAGGGAGGCCAGAGCTCGGTGG + Intronic
1168508866 19:56958654-56958676 CTGCACAGGCCACAGCTGTGGGG - Intergenic
927494857 2:23545534-23545556 CTCCACACCCCTGAGCTCTGCGG - Intronic
931855939 2:66301894-66301916 CAGGACTGGCCAGAGCTCTGTGG - Intergenic
931866482 2:66417790-66417812 CTACCCAGGCGATAGCTCAGAGG + Intergenic
932304700 2:70693741-70693763 CTAAACAGGCCACATGTCTGAGG - Intronic
932324593 2:70849508-70849530 CTACACAGGCCAGAACTCCTAGG + Intergenic
932455912 2:71849894-71849916 CTTCTCAGGCCAGGGCTATGGGG + Intergenic
933824276 2:86144493-86144515 ATCCTCAGGGCAGAGCTCTGGGG + Exonic
933990602 2:87631431-87631453 CTGCCCAGGACAGAGCCCTGTGG - Intergenic
934564072 2:95328852-95328874 CAGCAAAGGCCAGAGCTCGGAGG - Intronic
935579798 2:104746562-104746584 CCACACAAGACAGAGATCTGGGG + Intergenic
936303244 2:111319393-111319415 CTGCCCAGGACAGAGCCCTGTGG + Intergenic
938237755 2:129720548-129720570 CTCCACAGGGCAGGGCTCGGTGG + Intergenic
938383521 2:130849403-130849425 CCTCACAGGCCAGGGCACTGGGG - Intronic
938582572 2:132660462-132660484 TTTCACAGGCCAGAGCTGTAGGG - Intronic
945062843 2:205924010-205924032 CTCCATAGGGCAGAGCTCCGAGG - Intergenic
946365699 2:219247699-219247721 CTGCACAGAGAAGAGCTCTGGGG - Exonic
946580761 2:221126149-221126171 CTGAACAGTCCAGAGCTCTATGG - Intergenic
947137025 2:226985650-226985672 CTACAGCGGCCTGGGCTCTGTGG + Intronic
947448544 2:230183513-230183535 CAGCAGAGGCCAGGGCTCTGGGG + Intronic
1169027454 20:2382817-2382839 CTCCAGAGGGAAGAGCTCTGGGG - Intronic
1169472578 20:5900963-5900985 CTGCACAGGCCAGGCATCTGAGG + Intergenic
1170362773 20:15565653-15565675 TTACACAGGCTAGAGTTCAGCGG + Intronic
1170573343 20:17645092-17645114 CAAGAGAGGCCAGAGCTCTTGGG - Intronic
1170573491 20:17646107-17646129 CCACACAGGCCTGGGCTCAGGGG + Intronic
1171191621 20:23163159-23163181 CTGCACAGGCCAGCACTCAGTGG + Intergenic
1171897400 20:30821394-30821416 CCAGACAGGCCAAAGCTCAGAGG + Intergenic
1173166259 20:40689050-40689072 GGGCACAGCCCAGAGCTCTGGGG - Exonic
1174113303 20:48210865-48210887 CCACACAGACCAGAGCTCCCAGG - Intergenic
1174192933 20:48753126-48753148 CTGCTCAGTCTAGAGCTCTGGGG - Intronic
1174526299 20:51174621-51174643 TTGCACAGGCCAGAGCTCAGTGG + Intergenic
1175568968 20:60004477-60004499 CTACACAGGCCAGGGCGCCGTGG + Intronic
1176801228 21:13432605-13432627 TCACACAGGCCAGAGTTCAGTGG - Intergenic
1178807715 21:35853149-35853171 TTTCACAGTCCAGAGCTTTGTGG + Intronic
1179422874 21:41250044-41250066 CTTCTCAGGACAGAGATCTGTGG - Intronic
1180569397 22:16701298-16701320 CTACACAGCCCAGAGCTGCGAGG - Intergenic
1181114292 22:20621465-20621487 CTGCACTTGCCAGTGCTCTGGGG - Intergenic
1181152952 22:20898324-20898346 CTACCCAGGCTGGAGTTCTGTGG + Intergenic
1181543923 22:23590099-23590121 CAACAGAGCCCAGAGCTGTGTGG + Intergenic
1182100639 22:27655167-27655189 CTGCAGAGGCCAGAGCTTTTAGG - Intergenic
1182173677 22:28260428-28260450 CTTAACAGGCCAGACATCTGGGG + Intronic
1184090323 22:42289869-42289891 CCAAACATGCCAGAGCCCTGCGG + Intronic
1184906928 22:47494426-47494448 CTACACCTGGCAGTGCTCTGCGG + Intergenic
949982117 3:9508493-9508515 TTGAACAGGCCAGAGCTCAGGGG + Intronic
951807784 3:26665217-26665239 CTACCCAGAGCAGAGTTCTGTGG + Intronic
952303082 3:32121409-32121431 CTAGCCAGGGCGGAGCTCTGAGG - Intronic
956221085 3:66904053-66904075 CTACACAGAACAAAGCTCTGGGG + Intergenic
960962998 3:123085056-123085078 CCACACAGACCACAGCTCAGGGG - Intronic
961530157 3:127535761-127535783 CCACACAGGCCAGTGCTGAGGGG + Intergenic
961828300 3:129610340-129610362 CTGCCCAGGGCAGAGCTGTGAGG + Intergenic
962997981 3:140650785-140650807 CAACACAGGGCAGAACTCAGTGG + Intergenic
963876664 3:150483620-150483642 CTACATAGTCCAGATCCCTGGGG + Intergenic
963971039 3:151429761-151429783 CTGCCCAGGCCCGGGCTCTGAGG + Intronic
964027663 3:152097326-152097348 TGACACAGGGCAGAGCACTGAGG - Intergenic
965178676 3:165370634-165370656 CTACACAACCCATAGCTGTGAGG - Intergenic
969746968 4:9080163-9080185 TAACACAGGCCAAGGCTCTGGGG - Intergenic
971877798 4:32327014-32327036 CCACAGATGCCAGAGCTCAGAGG - Intergenic
973243521 4:47984776-47984798 GTACTCAGACCAGACCTCTGTGG + Intronic
974139300 4:57864297-57864319 CTACCCAGGCCAGAGTGCAGTGG + Intergenic
974235029 4:59169844-59169866 TTACACAGGCTGGAGCTCAGAGG + Intergenic
981007177 4:139888105-139888127 AGAGACAGGCCTGAGCTCTGTGG - Intronic
981181906 4:141755993-141756015 CTAAATTGGCCAGAGCTCAGGGG + Intergenic
983853506 4:172612928-172612950 ATAAATAGGCCAGGGCTCTGGGG - Intronic
985121893 4:186651772-186651794 GCTCACAGTCCAGAGCTCTGAGG - Intronic
987058451 5:14218646-14218668 CCACAGAAGCCACAGCTCTGTGG - Intronic
987794075 5:22605683-22605705 CTACACAGGCAAGGCCTGTGGGG - Intronic
988737858 5:34040543-34040565 GTACAATGGCCAGAGATCTGGGG - Intronic
990918850 5:60940304-60940326 CTGCAGAAGCCAGAACTCTGAGG + Intronic
991138060 5:63206460-63206482 CTACCCAATCCAGAACTCTGGGG - Intergenic
998310155 5:141122263-141122285 CTAGACCGGGAAGAGCTCTGTGG + Exonic
998317771 5:141200042-141200064 CTAGACAGGGAGGAGCTCTGCGG + Exonic
998318720 5:141209175-141209197 CTAGACAGGGAGGAGCTCTGTGG + Exonic
998848494 5:146333581-146333603 CAACACAGGCAAAAGCCCTGAGG - Intronic
1001019733 5:168172883-168172905 CTTCTCAGCCAAGAGCTCTGGGG + Intronic
1004192183 6:13473490-13473512 CCACAAATGACAGAGCTCTGGGG - Intronic
1004352702 6:14904146-14904168 CTACACAGGCCGAAGCTTTGAGG + Intergenic
1005290916 6:24377947-24377969 TTACCCAGGCCAGAGTGCTGTGG - Intergenic
1006795385 6:36728978-36729000 CTCCAGAGGCCAGGGCTGTGTGG - Intronic
1006887544 6:37395201-37395223 CTACACAGGACAGTGGTATGTGG - Intergenic
1006980302 6:38142380-38142402 CTAAACAGGCCACAGCTCCCTGG + Intronic
1006985636 6:38173769-38173791 CGACAGAGGCCGGAGCTCTGGGG + Exonic
1007413635 6:41679485-41679507 CTCCACCAGCCAGAGGTCTGTGG - Intergenic
1007617158 6:43186891-43186913 CTTCACAGGCCAAGGCTCAGAGG + Intronic
1013431543 6:110060854-110060876 CTCCTCAGTGCAGAGCTCTGTGG - Intergenic
1014155156 6:118101374-118101396 CTTCACAAGGCAGAGTTCTGTGG - Intronic
1018885645 6:167933963-167933985 CTGCACAGGCCAGGACTCTGGGG + Intronic
1019543015 7:1559928-1559950 CTCCACCGGCAAGAGCTATGCGG + Intronic
1020394694 7:7700846-7700868 TTACCCAGGCCAGAGTTCAGTGG - Intronic
1023861460 7:44219808-44219830 CCACACTGGCCAGAGCTGGGTGG - Intronic
1025607314 7:63048570-63048592 CCACACAGGCCAGTTCTTTGTGG + Intergenic
1032075720 7:128835224-128835246 CTCCTCGGGCCAGAGCTCTGGGG - Intronic
1032435977 7:131900729-131900751 CTACCCAAGCCAGAGCTCCCAGG + Intergenic
1033788899 7:144768007-144768029 CCACCCAGGCCAGAGCACAGTGG + Intronic
1034332417 7:150294325-150294347 CTACCCAGCCCAAAGCACTGAGG + Intronic
1034665621 7:152815553-152815575 CTACCCAGCCCAAAGCACTGAGG - Intronic
1034890017 7:154831310-154831332 CCACACAGGCCACAGTGCTGTGG + Intronic
1035871308 8:3138684-3138706 CTACACGTGCAAGAGCTCTGAGG + Intronic
1036731017 8:11264910-11264932 CACCACAAGCCAGAGCTCAGTGG + Intergenic
1038500174 8:28037316-28037338 GTACACAGGGCAGAGTTTTGGGG - Intronic
1039451899 8:37681844-37681866 CTGCCCAGGCCTGAGCTCGGCGG + Intergenic
1041710064 8:60886324-60886346 TAACAAAGCCCAGAGCTCTGGGG + Intergenic
1043549823 8:81358198-81358220 CTAGACAGTCCAGAGATCTGTGG - Intergenic
1047631480 8:126713455-126713477 CTCCAAAGGAGAGAGCTCTGAGG - Intergenic
1048251638 8:132871102-132871124 CTCCACAGGACCGTGCTCTGGGG + Intronic
1048806126 8:138242927-138242949 CCACACAGGCCTTACCTCTGAGG + Exonic
1048964939 8:139608580-139608602 CTGCACAGGACAGGGCTCTGTGG - Intronic
1049629906 8:143648206-143648228 CTAGACACGCCAGGGCTTTGAGG + Intronic
1050743340 9:8848102-8848124 ATACAACTGCCAGAGCTCTGGGG - Intronic
1054797540 9:69316690-69316712 CTCCACAGGCCACTGCTCTCTGG + Intergenic
1059435485 9:114273489-114273511 CTGCTGAGGCCTGAGCTCTGGGG - Intronic
1059653093 9:116333744-116333766 TTGCACAGCCCAGGGCTCTGAGG + Intronic
1060299837 9:122368795-122368817 ATACACAGGGGAGAGGTCTGGGG - Intergenic
1060469002 9:123931622-123931644 CTAGACAGGCAGGAGCTCTGTGG + Intergenic
1060748754 9:126155063-126155085 CTGCACAGCCCTGAGCCCTGGGG + Intergenic
1061394865 9:130338280-130338302 CAACACAGGGCAGAGCACAGTGG + Intronic
1062014091 9:134282611-134282633 CTGCAGAAGCCAGAGGTCTGTGG + Intergenic
1062029882 9:134357442-134357464 CTGCACAGGCGAGAAATCTGAGG - Intronic
1062429208 9:136519542-136519564 CTTCACCGGCCAGAACTGTGAGG - Exonic
1187199676 X:17122969-17122991 GTTCATAGGCCAGGGCTCTGAGG + Intronic
1187246141 X:17554388-17554410 ATACACAGGCCAGAGCTGGAGGG + Intronic
1188557137 X:31425502-31425524 CAACAAAGGACACAGCTCTGAGG + Intronic
1189995000 X:46629695-46629717 CTAGACTGGCCACAGTTCTGTGG + Intronic
1190066649 X:47245938-47245960 CAGCACAGGCCAAGGCTCTGGGG - Intronic
1190470218 X:50771047-50771069 CTAGACTGGCCTGAACTCTGTGG + Intronic
1191767864 X:64720019-64720041 CTACCCAGCCCAGACCTCAGGGG + Intergenic
1192239650 X:69319152-69319174 TTAAACAGCCCAGAGCCCTGGGG - Intergenic
1199105942 X:143867962-143867984 CTAGACAGATCAGAGATCTGAGG - Intergenic
1200081522 X:153579122-153579144 AGAGCCAGGCCAGAGCTCTGGGG + Intronic