ID: 1155386724

View in Genome Browser
Species Human (GRCh38)
Location 18:25285873-25285895
Sequence TACACAGGCCAGAGCTCTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 195}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155386717_1155386724 8 Left 1155386717 18:25285842-25285864 CCTCCATGTATCAGGACTGCCAC 0: 1
1: 0
2: 0
3: 5
4: 85
Right 1155386724 18:25285873-25285895 TACACAGGCCAGAGCTCTGAGGG 0: 1
1: 0
2: 0
3: 17
4: 195
1155386714_1155386724 24 Left 1155386714 18:25285826-25285848 CCCAGGCTTGAAATTGCCTCCAT 0: 1
1: 0
2: 0
3: 11
4: 149
Right 1155386724 18:25285873-25285895 TACACAGGCCAGAGCTCTGAGGG 0: 1
1: 0
2: 0
3: 17
4: 195
1155386715_1155386724 23 Left 1155386715 18:25285827-25285849 CCAGGCTTGAAATTGCCTCCATG 0: 1
1: 0
2: 0
3: 16
4: 109
Right 1155386724 18:25285873-25285895 TACACAGGCCAGAGCTCTGAGGG 0: 1
1: 0
2: 0
3: 17
4: 195
1155386718_1155386724 5 Left 1155386718 18:25285845-25285867 CCATGTATCAGGACTGCCACCCT 0: 1
1: 0
2: 2
3: 12
4: 129
Right 1155386724 18:25285873-25285895 TACACAGGCCAGAGCTCTGAGGG 0: 1
1: 0
2: 0
3: 17
4: 195

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155386724 Original CRISPR TACACAGGCCAGAGCTCTGA GGG Intronic
900294224 1:1940593-1940615 TAGACACGCCAGAGCCCTCACGG - Intronic
900316888 1:2061429-2061451 TCCAGAGGCCTGAGCTCTGAAGG + Intronic
900354093 1:2251591-2251613 TACACAGGCGAGGGCTCTACAGG - Intronic
900569133 1:3349781-3349803 CACAGAGGCCTGAGCTCTGCTGG + Intronic
900643198 1:3697067-3697089 TGCTCAGGCCAGAGCCCTGGAGG + Intronic
901018620 1:6245103-6245125 GGCACAGGCCAGAGCCCTGTGGG - Exonic
901084128 1:6600518-6600540 TTCACAGCCCTGAGCTCTAAAGG + Intronic
906292472 1:44628187-44628209 TACAGAGGACAGGCCTCTGAAGG - Intronic
907685143 1:56603659-56603681 TAGTCACCCCAGAGCTCTGATGG + Intronic
907706422 1:56836400-56836422 TACAGAGGACAGAGCCGTGATGG - Intergenic
908412636 1:63882375-63882397 ACCAGAGGCCAGAGCTCTAAAGG - Intronic
908795073 1:67823054-67823076 TACAGTAGACAGAGCTCTGATGG + Intronic
913664317 1:121033490-121033512 TTCAGAGGCCAGAACTCTGCTGG + Intergenic
914015707 1:143816769-143816791 TTCAGAGGCCAGAACTCTGCTGG + Intergenic
914162076 1:145144239-145144261 TTCAGAGGCCAGAACTCTGCTGG - Intergenic
914654327 1:149725310-149725332 TTCAGAGGCCAGAACTCTGCTGG + Intergenic
915698840 1:157771347-157771369 AACACAGTATAGAGCTCTGAGGG - Intronic
917298956 1:173552736-173552758 TAGTCATGCAAGAGCTCTGATGG + Intronic
917611282 1:176691469-176691491 TGCAGAGGGCAGAGCTCTGGAGG + Intronic
918403732 1:184191344-184191366 AACACAGCCCTGAGCTCTGCTGG + Intergenic
920635935 1:207703545-207703567 CAATCAGGCAAGAGCTCTGATGG + Intronic
921799313 1:219383500-219383522 TGCACAGGCCACATCTCTGATGG + Intergenic
924732882 1:246728131-246728153 TACACAGGCCAAAAGTCTGATGG - Intronic
1067343699 10:45423195-45423217 GGCAAAGGCCTGAGCTCTGAGGG + Intronic
1069625639 10:69866237-69866259 GACACAGACTGGAGCTCTGAGGG - Intronic
1069773159 10:70912019-70912041 TATGCAGCCCAGACCTCTGAGGG + Intergenic
1070161921 10:73872081-73872103 TACAGAGGTCAGATCTCGGAGGG - Intronic
1070825969 10:79390858-79390880 CACACAGGTCAGGGCTCTGTGGG + Intronic
1071009827 10:80924942-80924964 TAATCAGGACAGAGCCCTGATGG + Intergenic
1071455375 10:85845982-85846004 TGCACAGGGGAGAGCTCTGAGGG + Intronic
1071492169 10:86143524-86143546 GACAAAGTCCAGAGCTCTGTGGG - Intronic
1075198970 10:120386063-120386085 TCCACAGGCCACAGACCTGAGGG - Intergenic
1075302026 10:121333406-121333428 CACACATGCCAGAGCTCTTTAGG + Intergenic
1075572584 10:123556819-123556841 TGCACAGGCCAAGGCTCTGGAGG - Intergenic
1075869953 10:125764561-125764583 CACACCAGCCAGACCTCTGAAGG + Intergenic
1076208484 10:128622473-128622495 TACACAGGCCAGGGTTCAGGGGG - Intergenic
1076439373 10:130470149-130470171 CACACAGGCTAGTGCACTGATGG - Intergenic
1079489229 11:20968881-20968903 TTCACTGGCCAGAACTCAGATGG + Intronic
1079495183 11:21034734-21034756 GACACAGACCAGAGCTAAGAGGG + Intronic
1082211612 11:49509787-49509809 TAGTCAAGCAAGAGCTCTGATGG - Intergenic
1082896083 11:58191277-58191299 AACACAGGCCAGTCCTCCGAGGG + Exonic
1083192970 11:61065887-61065909 TACGCAGGCCAGACATCTGGGGG - Intergenic
1084982362 11:72836837-72836859 TGCACAGGTCAGGGCTCGGAGGG - Intronic
1086638031 11:89115291-89115313 TAGCCAAGCAAGAGCTCTGATGG + Intergenic
1086891007 11:92258347-92258369 TACAAAGGCAAGAGCTCCAAGGG + Intergenic
1090563272 11:127957273-127957295 AACATAGTCCATAGCTCTGAGGG + Intergenic
1091182944 11:133623405-133623427 CACACAGGCAGCAGCTCTGATGG + Intergenic
1091976223 12:4827722-4827744 TTCCCAGGGCAGAGCTGTGAGGG - Intronic
1092911422 12:13148380-13148402 AACACTGGCCAGAGTTCTGTAGG + Intergenic
1092976440 12:13749649-13749671 TAGTGAGACCAGAGCTCTGAAGG + Intronic
1101186221 12:102283496-102283518 TACAAAGGTCATAGCACTGAAGG - Intergenic
1102260919 12:111442841-111442863 GTCAAAGGCCAGAGCTCTGGTGG - Intronic
1105882257 13:24615223-24615245 TGCTCAGGCCAGAGCCCTTAGGG + Intergenic
1107741109 13:43451392-43451414 TACACAGGGCACTCCTCTGATGG + Intronic
1107912316 13:45116927-45116949 TACACAGGCCTGATCTCTTCAGG - Intergenic
1108450799 13:50561217-50561239 TACAAAGGCCAAATCTCAGAAGG - Intronic
1112589661 13:100751518-100751540 GACACAGGGCACAGCACTGATGG - Intergenic
1112865901 13:103898203-103898225 AACACAGGGCAGAGCTCAGCCGG - Intergenic
1113610236 13:111639500-111639522 GCCACAGGCCTGGGCTCTGAGGG - Intronic
1114063273 14:19038586-19038608 TCCACAGTCCAGAGCACAGAGGG + Intergenic
1114098982 14:19361409-19361431 TCCACAGTCCAGAGCACAGAGGG - Intergenic
1115013045 14:28573463-28573485 TACTCACCCAAGAGCTCTGATGG - Intergenic
1116536219 14:46034476-46034498 TTGCCAGGCCTGAGCTCTGACGG - Intergenic
1118914920 14:70094720-70094742 TACCCAGCTCAGAGCTCTGGAGG - Intronic
1119446988 14:74673274-74673296 TACACAGGATAGAGCTGTGGAGG - Intronic
1119936489 14:78596841-78596863 CACCCCTGCCAGAGCTCTGAGGG + Intronic
1121532450 14:94665228-94665250 GACACAGGCAAGAGCTGTGGAGG - Intergenic
1122018787 14:98819603-98819625 TGCCCAGGGCAGGGCTCTGAGGG + Intergenic
1124466318 15:29943003-29943025 TACCCTGGCCTGTGCTCTGATGG + Intronic
1124915088 15:33962404-33962426 TACTCAAGCCAGAGTTCTCAGGG + Intronic
1125680928 15:41529775-41529797 TAGAAAGGCCTGAGTTCTGAGGG + Intronic
1126976964 15:54194048-54194070 TGCAAAGGCCATATCTCTGAGGG + Intronic
1127029278 15:54844093-54844115 TCCAAAGGCAAGAGGTCTGAGGG - Intergenic
1128112490 15:65085500-65085522 AACACAGCCCAGAGAGCTGAGGG - Intergenic
1128794168 15:70452609-70452631 TCCGCAGGCCAGAATTCTGAGGG + Intergenic
1129367089 15:75062809-75062831 GGCACAGGCCAAAGCTCAGATGG + Intronic
1129367502 15:75065490-75065512 TGCAGAGGCCAGAGATCAGATGG + Intronic
1130085905 15:80778552-80778574 TGGACAGGCCAAAGTTCTGAAGG - Intergenic
1131388275 15:92026034-92026056 CACACAGAGCAGAGCTCTCAGGG - Intronic
1134345872 16:13391320-13391342 TACAAAGGCAAGACCTCAGATGG - Intergenic
1136071673 16:27791271-27791293 CACACAGGCCAGGGTTCTGGGGG + Exonic
1136378817 16:29881378-29881400 TACACCAGCCAGTTCTCTGAAGG - Intronic
1137336048 16:47550239-47550261 TACACAGGCCTAAGCACAGAAGG - Intronic
1141069101 16:80937195-80937217 AACACAGGGGAGAACTCTGATGG - Intergenic
1143565933 17:7720581-7720603 TACACTGACCAGTGCTCTCAGGG - Intronic
1146242672 17:31244550-31244572 AACACAGGGCAGAGCTCAGCTGG - Intronic
1146341041 17:32020365-32020387 CACACAGGGTAGATCTCTGAAGG + Intronic
1148960720 17:51390567-51390589 TAAACAGGCCACAGCTGTGAAGG + Intergenic
1150647988 17:66991827-66991849 TACAGAAGCCAGAGGTGTGAAGG + Intronic
1151164180 17:72190026-72190048 CACTTGGGCCAGAGCTCTGAAGG - Intergenic
1155386724 18:25285873-25285895 TACACAGGCCAGAGCTCTGAGGG + Intronic
1159633254 18:70774226-70774248 TAAAAAGGCCAGAGCACTCACGG + Intergenic
1159906136 18:74094086-74094108 TAGTCATGCAAGAGCTCTGATGG - Intronic
1160338819 18:78068557-78068579 TAACCAACCCAGAGCTCTGAAGG + Intergenic
1160399988 18:78603224-78603246 TACAGAGGCCAGCGATCTGTGGG - Intergenic
1160447749 18:78940521-78940543 TCCAAAGGCCTGAGCTGTGAGGG - Intergenic
1162183875 19:8889525-8889547 AACACAGGCCTGAGCTGTGGAGG + Exonic
1162702550 19:12528571-12528593 TACACAGGCCAGGTTTCTAAAGG + Exonic
1165655490 19:37528839-37528861 TGCCCAGGCCAGAGCTCCAAGGG - Intronic
1165824394 19:38697625-38697647 CACACAGGCCAAGGCTGTGAGGG + Intronic
1166878711 19:45914067-45914089 CCCACAGGCCAGAGCTCCGAGGG + Exonic
1167093233 19:47359063-47359085 TCTACAGGCCAGAGATCTGAGGG + Intronic
1167535272 19:50046576-50046598 TAGAAAGGCATGAGCTCTGACGG - Exonic
1167860923 19:52283407-52283429 AACACAGGTAAGAGCTCAGATGG + Exonic
1167864810 19:52315956-52315978 AACACAGGTAAGAGCTCAGATGG + Exonic
1167869286 19:52354373-52354395 AACACAGGTAAGAGCTCTGATGG + Exonic
1167873530 19:52392782-52392804 AACACAGGTAAGAGCTCAGATGG + Intergenic
1168306522 19:55438884-55438906 TGCCCAGGCTAGAGATCTGAGGG + Intronic
927435955 2:23066309-23066331 TACAGAGGCCAGCCTTCTGATGG - Intergenic
931866483 2:66417791-66417813 TACCCAGGCGATAGCTCAGAGGG + Intergenic
933824277 2:86144494-86144516 TCCTCAGGGCAGAGCTCTGGGGG + Exonic
937904496 2:127046236-127046258 TAAACAGGCCAGTGAGCTGAAGG - Intergenic
940153379 2:150627548-150627570 TACACAGGCCAAACATCAGAAGG + Intergenic
940340155 2:152571625-152571647 TACAAAGGCCTGAGCTTTGCAGG - Intronic
944420499 2:199525066-199525088 GACAAAGGCCAAACCTCTGAAGG - Intergenic
944497376 2:200321858-200321880 TTCAGATGACAGAGCTCTGAGGG + Intronic
945576718 2:211540073-211540095 TACACAGGCAATAGATTTGATGG - Intronic
946365219 2:219245090-219245112 GATACAGGCCAGAGCCCAGAAGG + Intronic
1169750649 20:8989942-8989964 TAGTCACGCAAGAGCTCTGATGG - Intergenic
1170592402 20:17780846-17780868 CACACAGGCCACGGCTCTGCAGG + Intergenic
1171090857 20:22284793-22284815 TACCCTGGCCATAGCTCTGCAGG + Intergenic
1174495569 20:50939253-50939275 TTCACAGGCCACAGTTTTGATGG - Intronic
1174935984 20:54869262-54869284 TACACATGCCAGAGCATTTAAGG - Intergenic
1176203963 20:63878114-63878136 TCCACTGCCCAGAGCTCTGCAGG + Intronic
1178436156 21:32560227-32560249 AACAGAAGCCAGAGCTGTGAAGG + Intergenic
1178807716 21:35853150-35853172 TTCACAGTCCAGAGCTTTGTGGG + Intronic
1179058561 21:37958302-37958324 GACACAGGGCGGAGGTCTGAAGG - Intronic
1180481765 22:15761215-15761237 TCCACAGTCCAGAGCACAGAGGG + Intergenic
1180699150 22:17772442-17772464 TCCAGAGGCCACAGCTCTGCAGG + Intronic
1180741533 22:18056323-18056345 GACACAGGCCACAGTTCAGATGG + Intergenic
1181776128 22:25161302-25161324 AACTGAGGCCAGGGCTCTGATGG + Intronic
1182100638 22:27655166-27655188 TGCAGAGGCCAGAGCTTTTAGGG - Intergenic
1183023206 22:35043851-35043873 AGCACAGGCAGGAGCTCTGAGGG - Intergenic
1184116698 22:42426616-42426638 CACTCAGGCCAGAGCCCTGATGG - Intronic
1185017674 22:48354284-48354306 GACAGGGGCCAGAGCTCCGACGG - Intergenic
952542086 3:34377295-34377317 GACACAGGCCTGAGCTCTAAAGG - Intergenic
953367294 3:42356391-42356413 TAGACACTCAAGAGCTCTGATGG + Intergenic
954893594 3:53955883-53955905 TACATAGGTCTGAGCTCTGCTGG - Intergenic
956019307 3:64916441-64916463 GTCACAGGGCAGAGGTCTGACGG - Intergenic
956055253 3:65291689-65291711 TACACAGCCCTCAGCTCTGTTGG - Intergenic
956221086 3:66904054-66904076 TACACAGAACAAAGCTCTGGGGG + Intergenic
961313279 3:126017331-126017353 GACCCAGGCCATAGCCCTGACGG - Intronic
963635312 3:147787476-147787498 AACACAGGCCAGATGTGTGAAGG - Intergenic
963971040 3:151429762-151429784 TGCCCAGGCCCGGGCTCTGAGGG + Intronic
966236870 3:177711659-177711681 TTCAGAGGGCAGAGCTCTAATGG + Intergenic
969103324 4:4786289-4786311 GACACAGGCCATTGCTCAGAGGG - Intergenic
969377292 4:6771373-6771395 CCCACAGGCCTGAGCTCTGCAGG + Intergenic
973243522 4:47984777-47984799 TACTCAGACCAGACCTCTGTGGG + Intronic
977917542 4:102611154-102611176 TCCACAGGGCTGAGATCTGAAGG + Intronic
979102540 4:116638774-116638796 TACACAGCCTAGGGCTCTGCAGG + Intergenic
979368792 4:119858291-119858313 GACAGAGGAAAGAGCTCTGAGGG + Intergenic
983147360 4:164233501-164233523 TAAACAGACCAAGGCTCTGAGGG - Intronic
984646011 4:182220450-182220472 TACACTGTTCAGGGCTCTGACGG + Intronic
985121892 4:186651771-186651793 CTCACAGTCCAGAGCTCTGAGGG - Intronic
986432041 5:7691068-7691090 TACAGAAGCCAGGGCTATGAAGG - Intronic
990370606 5:55114513-55114535 TACAGGGGCAAGAGCACTGAGGG - Intronic
992907613 5:81361791-81361813 TGCACAGGCCAGATCATTGAAGG - Intronic
994332319 5:98521446-98521468 TGCACAGGCCATAGGTCTGCTGG + Intergenic
999288995 5:150411379-150411401 TTCACAGGCCACAGCTCTAATGG + Intronic
999820049 5:155217889-155217911 TACACAGACCACAGATTTGATGG - Intergenic
1003291897 6:4786974-4786996 TTCCCAGGCCAGAGCTCTGCAGG - Intronic
1006902859 6:37514218-37514240 TTCAAAGGCCAGTGCCCTGAAGG + Intergenic
1007345811 6:41228666-41228688 AACCCAGGTCAGAGCTCTGAAGG - Intronic
1007617159 6:43186892-43186914 TTCACAGGCCAAGGCTCAGAGGG + Intronic
1008743991 6:54646563-54646585 TACACAAGCCAGAGACCAGAGGG - Intergenic
1013475897 6:110507043-110507065 TAGCCAGAACAGAGCTCTGAAGG + Intergenic
1013721618 6:113036959-113036981 TACACAACCCCGATCTCTGAGGG + Intergenic
1016014818 6:139172991-139173013 TACAGAGGCCACAGCTGAGAAGG - Intronic
1016517055 6:144906633-144906655 AACACAGGCATGAGCTCTCAGGG + Intergenic
1020529018 7:9306036-9306058 TAAAGAGGCCAAAGCTATGATGG + Intergenic
1020901815 7:14012986-14013008 TACATGGGCCTGAGCTCAGATGG + Intergenic
1021799964 7:24295414-24295436 AACAGAGGCCAGAGGTCTCATGG + Intergenic
1022364842 7:29702482-29702504 TATGCAGGCAGGAGCTCTGATGG - Intergenic
1024356327 7:48416840-48416862 TTAACAGGCCCGAGCTCTGTAGG - Intronic
1025933044 7:66011700-66011722 CACCCAGGCCAGAAATCTGAGGG + Intergenic
1031657742 7:124379521-124379543 TACACTGGGCAGAACTCAGATGG + Intergenic
1031884505 7:127231821-127231843 TACAGAGGCCACAGGTTTGATGG - Intronic
1032435978 7:131900730-131900752 TACCCAAGCCAGAGCTCCCAGGG + Intergenic
1032837256 7:135685668-135685690 TAGAGAGGCCAGAGCTCTGTAGG + Exonic
1034332418 7:150294326-150294348 TACCCAGCCCAAAGCACTGAGGG + Intronic
1034592371 7:152152513-152152535 TACACAGGCCAAAGCACTAGAGG + Intronic
1034665620 7:152815552-152815574 TACCCAGCCCAAAGCACTGAGGG - Intronic
1035295127 7:157862958-157862980 CACAAAGCCCAGAGCTCGGACGG + Intronic
1037339130 8:17823762-17823784 TACACAGTTCAGAGATCTGCAGG - Intergenic
1037346582 8:17907612-17907634 TGCACAGGCCTGTGGTCTGACGG - Intronic
1037347590 8:17916136-17916158 TGCACAGGCCTGTGGTCTGACGG - Intergenic
1038500173 8:28037315-28037337 TACACAGGGCAGAGTTTTGGGGG - Intronic
1038580770 8:28747394-28747416 GACACAGGCCAGTGCTCAAAGGG - Intronic
1039977361 8:42378700-42378722 TACACAGGCGAAAGAACTGACGG + Intergenic
1043549822 8:81358197-81358219 TAGACAGTCCAGAGATCTGTGGG - Intergenic
1046086300 8:109439935-109439957 TTCACAGGGCAGAGCTCACATGG + Intronic
1047631328 8:126711805-126711827 GACACAGGCCCTAGCTGTGAGGG + Intergenic
1048583244 8:135748350-135748372 TACACAACCCAGGGCTCTGCTGG - Intergenic
1049302197 8:141877429-141877451 TCCTCAGGCCAGTGCTCAGAAGG + Intergenic
1054926086 9:70590020-70590042 TCCACAGTCCAGGGCTCAGACGG + Intronic
1055382772 9:75726859-75726881 TACACAGTCCAGATCTTTCATGG - Intergenic
1055663188 9:78527287-78527309 CACACAGGCAAGACATCTGAAGG - Intergenic
1060356935 9:122917664-122917686 TGCACAGGACAAAACTCTGATGG + Exonic
1061033564 9:128101233-128101255 TGGACCGGCCACAGCTCTGAAGG - Intronic
1062053675 9:134459783-134459805 CACACAGGGCAGAGCCTTGAGGG - Intergenic
1062179317 9:135182431-135182453 TGCCCAGGCCACAGCACTGATGG + Intergenic
1187246142 X:17554389-17554411 TACACAGGCCAGAGCTGGAGGGG + Intronic
1189179520 X:38990111-38990133 TACAGAAGACAGAGCCCTGATGG - Intergenic
1189634200 X:42987659-42987681 TACCCAGGCAAGAACTCTCAGGG - Intergenic
1191825370 X:65359204-65359226 TAGTCACGCAAGAGCTCTGATGG + Intergenic
1192841111 X:74857168-74857190 TACACAAGCCAGGGCAGTGAAGG + Intronic
1194100379 X:89696061-89696083 TAGACACCCCAGAGCTCTGAAGG - Intergenic
1195819029 X:108922760-108922782 TACTCACCCAAGAGCTCTGATGG + Intergenic
1198045615 X:132898802-132898824 TACATAGGAGAGAGCTCTGGAGG + Intronic
1199105941 X:143867961-143867983 TAGACAGATCAGAGATCTGAGGG - Intergenic
1199512855 X:148642150-148642172 TACTCAGGCCGGGGCTCTGCAGG + Intronic
1200097326 X:153670330-153670352 CCCACAGGCCAGAGGACTGAAGG - Intronic
1200453383 Y:3357423-3357445 TAGACACCCCAGAGCTCTGAAGG - Intergenic