ID: 1155386726

View in Genome Browser
Species Human (GRCh38)
Location 18:25285888-25285910
Sequence TCTGAGGGTATAATGAGCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 166}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155386721_1155386726 1 Left 1155386721 18:25285864-25285886 CCCTTTTGCTACACAGGCCAGAG 0: 1
1: 0
2: 0
3: 13
4: 196
Right 1155386726 18:25285888-25285910 TCTGAGGGTATAATGAGCAAAGG 0: 1
1: 0
2: 0
3: 10
4: 166
1155386720_1155386726 4 Left 1155386720 18:25285861-25285883 CCACCCTTTTGCTACACAGGCCA 0: 1
1: 0
2: 0
3: 26
4: 194
Right 1155386726 18:25285888-25285910 TCTGAGGGTATAATGAGCAAAGG 0: 1
1: 0
2: 0
3: 10
4: 166
1155386718_1155386726 20 Left 1155386718 18:25285845-25285867 CCATGTATCAGGACTGCCACCCT 0: 1
1: 0
2: 2
3: 12
4: 129
Right 1155386726 18:25285888-25285910 TCTGAGGGTATAATGAGCAAAGG 0: 1
1: 0
2: 0
3: 10
4: 166
1155386722_1155386726 0 Left 1155386722 18:25285865-25285887 CCTTTTGCTACACAGGCCAGAGC 0: 1
1: 0
2: 2
3: 11
4: 155
Right 1155386726 18:25285888-25285910 TCTGAGGGTATAATGAGCAAAGG 0: 1
1: 0
2: 0
3: 10
4: 166
1155386717_1155386726 23 Left 1155386717 18:25285842-25285864 CCTCCATGTATCAGGACTGCCAC 0: 1
1: 0
2: 0
3: 5
4: 85
Right 1155386726 18:25285888-25285910 TCTGAGGGTATAATGAGCAAAGG 0: 1
1: 0
2: 0
3: 10
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155386726 Original CRISPR TCTGAGGGTATAATGAGCAA AGG Intronic
903131053 1:21279782-21279804 TATGAGGGTTTAATGAGCTAAGG - Intronic
904337043 1:29804688-29804710 TCAGAGATTATAATCAGCAAGGG + Intergenic
904934442 1:34119587-34119609 TCTGATTTTAAAATGAGCAAAGG + Intronic
907727414 1:57032562-57032584 TCTGGGAGTATCATGGGCAATGG - Intronic
908428170 1:64029380-64029402 TCAGAGGGTATATTGACCAATGG - Intronic
908631220 1:66110216-66110238 TTTGAGGGAATAATAACCAATGG + Intronic
910316502 1:85890566-85890588 CCTGATGGAAAAATGAGCAAAGG - Intronic
910797774 1:91115999-91116021 AATGAGGGAATAATTAGCAAAGG + Intergenic
911810903 1:102279179-102279201 TCTGATTTTAAAATGAGCAAAGG + Intergenic
912419020 1:109530993-109531015 ACTGAGGGTATAAATAGCAGAGG - Intergenic
915546658 1:156602743-156602765 TATGAGGATGTATTGAGCAAAGG + Intergenic
915689980 1:157679295-157679317 TCTGGGGTTATAATGAGCAGAGG - Intronic
918899790 1:190399954-190399976 TGTGATGGTTTAAGGAGCAATGG - Intronic
919492729 1:198226182-198226204 TCTGAGGGCATGATAAGTAATGG + Intronic
920408183 1:205736017-205736039 TTTGAGGCTATAGTGAGCTATGG - Intronic
920971553 1:210747425-210747447 TCTGAGTGTAAAGTGAGGAAGGG + Intronic
921798825 1:219378695-219378717 ACTGAGGGCATAATGAGACATGG + Intergenic
922850669 1:228731156-228731178 TTTTAGGGGATTATGAGCAAGGG + Intergenic
923949830 1:238936706-238936728 TCTGGGGGTATAAAGAGTAGGGG + Intergenic
1067306050 10:45065074-45065096 TCTGAGGGACTAAAGAGAAATGG + Intergenic
1067759756 10:49035768-49035790 TTTGAGGCTATAGTGAGCTACGG + Intronic
1070104969 10:73423078-73423100 CCTGAGAGTATGATGAGAAAAGG + Intergenic
1071858202 10:89646560-89646582 GCTGAGGTTATTAAGAGCAAAGG + Intergenic
1074148817 10:110740415-110740437 TCTGAGTGTTTCATGGGCAAGGG + Intronic
1074695087 10:116043327-116043349 TTTTAGGGTATCTTGAGCAATGG - Intergenic
1075321802 10:121497233-121497255 TTTGAGGCTATCATGACCAAGGG - Intronic
1075727996 10:124620451-124620473 TCTGAGGGGAGACTGAGGAAGGG - Exonic
1077838199 11:5943817-5943839 TCAGAGGATGCAATGAGCAAAGG + Intergenic
1082267548 11:50135690-50135712 TGTGGGGGTATCATCAGCAAAGG - Intergenic
1082829596 11:57605988-57606010 TCTGGGGGTATGTTGAGAAAGGG - Exonic
1083780155 11:64913572-64913594 GCTGAGGGTCTGAGGAGCAAGGG - Intronic
1085902463 11:80717862-80717884 TCTGTGGGTTTAATGAACCATGG - Intergenic
1087157677 11:94920920-94920942 TTTGAGGGTAGCAAGAGCAAAGG + Intergenic
1089819033 11:121205093-121205115 TCTTAAGATATCATGAGCAATGG + Intergenic
1091261937 11:134241523-134241545 CCTGAGGCTATAAGGAGAAAGGG - Intronic
1094420776 12:30268903-30268925 TGTGAGGATTAAATGAGCAAAGG - Intergenic
1098250538 12:68565135-68565157 TCTGAGGTTTGAATGATCAAAGG - Intergenic
1103539556 12:121656389-121656411 GCTGAGGTTATAGTGAGCTATGG - Intronic
1104305108 12:127602987-127603009 TATGAGGATATTATGAGAAAGGG - Intergenic
1106061619 13:26298379-26298401 TCTGAGACTAATATGAGCAAAGG - Intronic
1106464264 13:29998922-29998944 CCTGAGGTTATAATTAGCCATGG - Intergenic
1110892838 13:80711907-80711929 TGTGAGATTATAATGAACAATGG - Intergenic
1111555487 13:89875891-89875913 TCAGAGCGCATAATGAGAAAAGG - Intergenic
1111904630 13:94240869-94240891 CCTGAGGGTATATTGCACAAGGG + Intronic
1113128479 13:107007534-107007556 TCTGAGGGTAGAATTGGCCACGG + Intergenic
1113668613 13:112159699-112159721 TCTGAAGGAACAATGAGAAACGG - Intergenic
1115735833 14:36328783-36328805 TTTGAGGTTACAATGAGCTATGG - Intergenic
1119991952 14:79208020-79208042 CCAGAGGGTATAAAGAGGAAGGG + Intronic
1124203747 15:27699799-27699821 TCTGAGGATAAAATGAGTCAAGG + Intergenic
1124551959 15:30689763-30689785 TCTGAGGGTACAATAAGAACGGG - Intronic
1124663626 15:31571603-31571625 TATGAGGGTTAAATGAGAAAAGG + Intronic
1124679285 15:31715908-31715930 TCTGAGGGTACAATAAGAACGGG + Intronic
1125108117 15:35997776-35997798 TATGAGAGTATACTGAACAAAGG - Intergenic
1125910132 15:43430013-43430035 TCTGAGAGAATAAGGAGAAAAGG + Intronic
1126126806 15:45301656-45301678 GTTGAGGCTATAATGAGCTATGG - Intergenic
1127094103 15:55495665-55495687 TTTGAGGTTACAATGAGCTATGG + Intronic
1127499561 15:59543691-59543713 TCTGAGGGTATAAGGCTGAAGGG + Intergenic
1128688106 15:69702163-69702185 CCTGAGGGTAGATTGAGCTATGG + Intergenic
1130240029 15:82179474-82179496 TCTGAGGGTAGCATGGGGAAAGG + Intronic
1135144565 16:19950180-19950202 TCTGATGGTAATGTGAGCAATGG + Intergenic
1135291823 16:21246129-21246151 TATGAGAGTATATTGAACAAAGG + Intronic
1135682799 16:24472696-24472718 TCTGGGGGAACAATGAGAAAAGG - Intergenic
1139061985 16:63263771-63263793 TCTGAGGGCAAGAGGAGCAAGGG + Intergenic
1141050715 16:80760927-80760949 TCTGTGGATTTAATGCGCAAAGG + Intronic
1143049647 17:4113899-4113921 TCTGAGGTTACAGTGAGCTATGG + Intronic
1145088521 17:19965562-19965584 TTTGAGGATATATTGGGCAAAGG - Intronic
1146714987 17:35078368-35078390 TTTGAGGTTATAATGAACTATGG - Intronic
1146778234 17:35641508-35641530 TTTGAGGCTACAATGAGCTATGG + Intronic
1147561240 17:41510636-41510658 TTTGGGGGTATATTCAGCAAAGG - Intergenic
1149227045 17:54484377-54484399 TCTGAGTGGATAATGATGAAAGG - Intergenic
1150914250 17:69420819-69420841 GCTGATGGTATAATGAGCAGGGG + Intronic
1153363545 18:4226344-4226366 TCTGAAGGTATAAAAATCAATGG + Intronic
1155369439 18:25082311-25082333 TCTAAGGATGTAAAGAGCAAAGG + Intronic
1155386726 18:25285888-25285910 TCTGAGGGTATAATGAGCAAAGG + Intronic
1156830153 18:41482264-41482286 ACTCAGAGTATAAAGAGCAAAGG - Intergenic
1157221091 18:45828934-45828956 TGGGAGGGTTTAATGAGCCAGGG + Intronic
1158862150 18:61603172-61603194 TCTGAGGCTATAGGGACCAAAGG + Intergenic
1163315649 19:16538857-16538879 CCTGATGGTGTAATGAGCAGGGG - Intronic
1165058325 19:33192988-33193010 TTTGAGGGTACAGTGAGCTATGG + Intronic
1165929128 19:39344672-39344694 TCTGAAGGGATAATGGGAAAAGG - Intronic
930062046 2:47298131-47298153 AGTGAGTGTATAATGAGGAAAGG - Intergenic
931496273 2:62810577-62810599 AATGTGGGTAAAATGAGCAATGG + Intronic
931830650 2:66047595-66047617 GCTGAGATTTTAATGAGCAAAGG - Intergenic
934704090 2:96464225-96464247 TCTGTGTGTGTACTGAGCAATGG + Intergenic
939212676 2:139196919-139196941 TCTGAGCATATATTTAGCAAAGG + Intergenic
939291627 2:140203519-140203541 TCAGAAGGTAATATGAGCAATGG + Intergenic
941983429 2:171485885-171485907 ACTCAGGTTATAATGAGGAAAGG - Intergenic
942022828 2:171883926-171883948 TCTGAGGTTACAGTGAGCTAGGG - Intronic
942799003 2:179855295-179855317 TCTGAGTTTATAATGGGAAATGG - Intronic
945876631 2:215284685-215284707 TTTGAGGTTACAATGAGCTATGG + Intergenic
948741145 2:240046693-240046715 TCTGAGGGGAATATCAGCAAGGG + Intergenic
1169859878 20:10140293-10140315 TCTGAAGGTATATAGAGGAATGG + Intergenic
1172823622 20:37761095-37761117 TCTGATGGAATAATCAGGAAGGG + Intronic
1174447563 20:50601061-50601083 TCTGAGGGCATAAGGACCGAGGG + Intronic
1175580348 20:60094040-60094062 TCTGAGGGTAAGAGGAGCAAAGG + Intergenic
1176689243 21:9883357-9883379 TCTGAGGGCATTATGGGCAGGGG + Intergenic
1177382941 21:20369172-20369194 TCTGAGGGTTTTCTGAGCCAGGG + Intergenic
1178495537 21:33082856-33082878 TATCAGGGTATCATGAGCAGTGG - Intergenic
1179727902 21:43350522-43350544 TCTGAGGGGACATTGAGCATAGG + Intergenic
1179807543 21:43849515-43849537 AATTAGTGTATAATGAGCAATGG + Intergenic
1180025720 21:45160950-45160972 TCTGAGAGTATAAATAGCCAGGG + Intronic
1183170090 22:36181381-36181403 TTAGAGTGTATAATGGGCAAAGG + Intergenic
949443168 3:4105224-4105246 TGGGAGGGTAGAATGAGAAAAGG + Intronic
950801756 3:15557638-15557660 TCTGAGAGTATGATTAGGAAAGG + Intergenic
953453732 3:43025234-43025256 ACAGAGGGTCTAATGAGAAACGG + Intronic
953891453 3:46754503-46754525 TCTGTGGCTATAATGACCAAGGG - Exonic
953896938 3:46810171-46810193 TCTGTGGCTATAATGACCAAGGG - Intronic
954415267 3:50390393-50390415 TCTGAGGGTATGAAGAGAACAGG + Intronic
957797137 3:85024249-85024271 TCTGAAAGTAAAATGAGGAAAGG - Intronic
957945750 3:87060276-87060298 TGTAAGGGAATAAAGAGCAATGG + Intergenic
958133123 3:89454924-89454946 TTTGAGGTTACAGTGAGCAATGG + Intronic
959696113 3:109250406-109250428 TGAGAGGGGATAATGAGGAATGG + Intergenic
960549384 3:118957078-118957100 TCTGAGGGTCTAAGAAGCAGTGG + Intronic
960821734 3:121740565-121740587 TCTTAGGGAATACTAAGCAAAGG + Intronic
961763798 3:129192402-129192424 ACTGAGAGTATAATTAGCTATGG - Intergenic
962760836 3:138512159-138512181 GCTGAGGTTAAAATGGGCAAAGG + Intronic
962962219 3:140321464-140321486 CCTGAGGGTGTAGGGAGCAAGGG - Intronic
963279123 3:143364481-143364503 TCTGAGGATGTAATGACCCACGG + Intronic
972528141 4:39936500-39936522 GCGGAGGTTATAATGAGCCACGG - Intronic
972603689 4:40594658-40594680 TATGAGGATAGCATGAGCAAAGG - Intronic
972705785 4:41541247-41541269 TCTAAGGGTCTAATAAGCTATGG - Intronic
975482449 4:74896321-74896343 TGTGAGGGGATAGTGAGGAAAGG - Intergenic
975649813 4:76581591-76581613 CCTGAGTGTAAAATGAGCATTGG + Intronic
975905019 4:79199426-79199448 TCTGATGCCATAATGAGCTAAGG - Intergenic
975921334 4:79393796-79393818 TTTGAGGTTACAATGAGCTATGG - Intergenic
977440998 4:97067401-97067423 TGTGAGGGTAAAATGAGATAAGG - Intergenic
979148571 4:117278410-117278432 TGTGAGGGGATCAGGAGCAAGGG - Intergenic
979645901 4:123068323-123068345 TCTGTGGAAATAAAGAGCAAAGG + Intronic
979950262 4:126883944-126883966 TCTGATAATATGATGAGCAAAGG + Intergenic
980393236 4:132172412-132172434 TCTCAGGGTAAAGTTAGCAATGG + Intergenic
982739237 4:159040531-159040553 TTTGAGGCTATAGTGAGCTATGG - Intergenic
983629599 4:169836614-169836636 TTTGAGGCTATAGTGAGCTATGG + Intergenic
984185872 4:176543199-176543221 TCTGAGGGAAAAAGGAGCATAGG + Intergenic
984529513 4:180899740-180899762 TCTGAAGGTATAATGCTCACTGG - Intergenic
987224986 5:15830911-15830933 TCTAAGGGTAAAAAGAACAAGGG - Intronic
991181644 5:63758309-63758331 TATGAGAGTATATTGAACAAAGG - Intergenic
992334367 5:75750086-75750108 TCTGAGGCTGCAGTGAGCAATGG + Intergenic
992352433 5:75944083-75944105 TTTGAGGTTATAGTGAGCTATGG - Intergenic
993494968 5:88597987-88598009 TTTGAGGGTCTAGTGAGCACTGG + Intergenic
993552644 5:89293439-89293461 TCTGATACTATAAAGAGCAAAGG + Intergenic
996155285 5:120091838-120091860 TCTGTTGTTATAATGAGCCAGGG + Intergenic
1004266978 6:14157241-14157263 ACTGAGGGTGCAATGAGCCAAGG - Intergenic
1006869403 6:37237052-37237074 TCTGAGGCTAGAATAAGAAAAGG - Intronic
1006992526 6:38227712-38227734 TCTGAGAGTATAATGGAGAAGGG + Intronic
1007231979 6:40354556-40354578 TCTGAGGGTGAAATGAGAAATGG + Intergenic
1008047640 6:46867585-46867607 TCTGGGGCCATGATGAGCAAGGG - Intronic
1008515232 6:52312632-52312654 ACTGAGGATACAATGAACAATGG - Intergenic
1010782802 6:79964767-79964789 AATGATGGTATAATGAGCATGGG - Intergenic
1013196900 6:107852039-107852061 ACTGAGTGTTGAATGAGCAAGGG + Intergenic
1013611969 6:111804257-111804279 TCTGAGGGTTTTATGATCACAGG - Intronic
1021781617 7:24112612-24112634 TCTGATGGTAGTATGAGAAATGG - Intergenic
1024377941 7:48660055-48660077 ACTGAGGGCATCCTGAGCAAGGG + Intergenic
1027594508 7:80156494-80156516 TCTGAGGTTAGAGTGAGCTATGG - Intronic
1030394139 7:108964363-108964385 ACTGAGCGTAGAATGAGCAGGGG + Intergenic
1030554167 7:111002556-111002578 TCAGAGGCTATAATGAGAAGGGG + Intronic
1034566738 7:151921582-151921604 TCAGAGGGAGAAATGAGCAAGGG + Intergenic
1037517615 8:19648735-19648757 ACTGAGGGTATAGTGAGCCATGG + Intronic
1038587751 8:28805626-28805648 TCATAGGGTATGATGTGCAAAGG + Intronic
1043243657 8:77970568-77970590 TGTGAGTGTATGAAGAGCAATGG - Intergenic
1045382486 8:101641306-101641328 TCTGAGGATAACATGGGCAAGGG + Intronic
1050423402 9:5490222-5490244 TCTGCGGGTATAATGTCCAAGGG - Intergenic
1052136958 9:24924278-24924300 TCTGAAGTTCTAATGTGCAAAGG - Intergenic
1052560878 9:30081062-30081084 TTTGAGGCTGCAATGAGCAATGG + Intergenic
1053780084 9:41598539-41598561 TCTGAGGGCATTATGGGCAGGGG - Intergenic
1054168041 9:61808782-61808804 TCTGAGGGCATTATGGGCAGGGG - Intergenic
1054669505 9:67772122-67772144 TCTGAGGGCATTATGGGCAGGGG + Intergenic
1185827617 X:3267252-3267274 GCTGAGGTTATAGTGAGCTATGG - Intergenic
1188699834 X:33244953-33244975 TCTAAGTGTATCATGAGAAATGG + Intronic
1190042521 X:47082694-47082716 TCTGAGGGTAGAATGGGGATGGG + Intronic
1192499391 X:71639573-71639595 TCTGAGTGTATTATAAGCAGAGG - Intergenic
1192847274 X:74919372-74919394 CTTGAGGGTATAATGAGCTTTGG - Intronic
1193342736 X:80369988-80370010 TTTGAGGCTATAGTGAGCTATGG - Intronic
1194429013 X:93777609-93777631 AGTGAGGGTGAAATGAGCAAAGG - Intergenic
1196543663 X:116937843-116937865 TCTGAGGCTACACAGAGCAAGGG + Intergenic
1199799662 X:151237016-151237038 ACTGAGGCTATAAGGAGGAAAGG - Intergenic
1200384223 X:155873597-155873619 TCTAAGGATATAGTGAACAATGG - Intergenic
1201932795 Y:19372196-19372218 TTTGAGGGCATAATATGCAAAGG - Intergenic