ID: 1155387279

View in Genome Browser
Species Human (GRCh38)
Location 18:25292331-25292353
Sequence TGGTACAGATGGTGACTGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155387279_1155387283 21 Left 1155387279 18:25292331-25292353 CCTCTCAGTCACCATCTGTACCA No data
Right 1155387283 18:25292375-25292397 CATGAGTTGCCTTAATGTCAGGG No data
1155387279_1155387282 20 Left 1155387279 18:25292331-25292353 CCTCTCAGTCACCATCTGTACCA No data
Right 1155387282 18:25292374-25292396 ACATGAGTTGCCTTAATGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155387279 Original CRISPR TGGTACAGATGGTGACTGAG AGG (reversed) Intronic