ID: 1155400113

View in Genome Browser
Species Human (GRCh38)
Location 18:25428979-25429001
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155400113_1155400121 25 Left 1155400113 18:25428979-25429001 CCCAAAGCAGACACACTCTGCAA No data
Right 1155400121 18:25429027-25429049 TCTAGGGATGAATCTCTGTGTGG No data
1155400113_1155400119 9 Left 1155400113 18:25428979-25429001 CCCAAAGCAGACACACTCTGCAA No data
Right 1155400119 18:25429011-25429033 CACCAACTGAAGAGATTCTAGGG No data
1155400113_1155400123 30 Left 1155400113 18:25428979-25429001 CCCAAAGCAGACACACTCTGCAA No data
Right 1155400123 18:25429032-25429054 GGATGAATCTCTGTGTGGGTAGG No data
1155400113_1155400118 8 Left 1155400113 18:25428979-25429001 CCCAAAGCAGACACACTCTGCAA No data
Right 1155400118 18:25429010-25429032 CCACCAACTGAAGAGATTCTAGG No data
1155400113_1155400122 26 Left 1155400113 18:25428979-25429001 CCCAAAGCAGACACACTCTGCAA No data
Right 1155400122 18:25429028-25429050 CTAGGGATGAATCTCTGTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155400113 Original CRISPR TTGCAGAGTGTGTCTGCTTT GGG (reversed) Intergenic