ID: 1155400114

View in Genome Browser
Species Human (GRCh38)
Location 18:25428980-25429002
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155400114_1155400119 8 Left 1155400114 18:25428980-25429002 CCAAAGCAGACACACTCTGCAAC No data
Right 1155400119 18:25429011-25429033 CACCAACTGAAGAGATTCTAGGG No data
1155400114_1155400121 24 Left 1155400114 18:25428980-25429002 CCAAAGCAGACACACTCTGCAAC No data
Right 1155400121 18:25429027-25429049 TCTAGGGATGAATCTCTGTGTGG No data
1155400114_1155400122 25 Left 1155400114 18:25428980-25429002 CCAAAGCAGACACACTCTGCAAC No data
Right 1155400122 18:25429028-25429050 CTAGGGATGAATCTCTGTGTGGG No data
1155400114_1155400118 7 Left 1155400114 18:25428980-25429002 CCAAAGCAGACACACTCTGCAAC No data
Right 1155400118 18:25429010-25429032 CCACCAACTGAAGAGATTCTAGG No data
1155400114_1155400123 29 Left 1155400114 18:25428980-25429002 CCAAAGCAGACACACTCTGCAAC No data
Right 1155400123 18:25429032-25429054 GGATGAATCTCTGTGTGGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155400114 Original CRISPR GTTGCAGAGTGTGTCTGCTT TGG (reversed) Intergenic