ID: 1155400115

View in Genome Browser
Species Human (GRCh38)
Location 18:25429002-25429024
Sequence CTCTTCAGTTGGTGGCAACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155400115_1155400121 2 Left 1155400115 18:25429002-25429024 CCCAGTTGCCACCAACTGAAGAG No data
Right 1155400121 18:25429027-25429049 TCTAGGGATGAATCTCTGTGTGG No data
1155400115_1155400123 7 Left 1155400115 18:25429002-25429024 CCCAGTTGCCACCAACTGAAGAG No data
Right 1155400123 18:25429032-25429054 GGATGAATCTCTGTGTGGGTAGG No data
1155400115_1155400122 3 Left 1155400115 18:25429002-25429024 CCCAGTTGCCACCAACTGAAGAG No data
Right 1155400122 18:25429028-25429050 CTAGGGATGAATCTCTGTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155400115 Original CRISPR CTCTTCAGTTGGTGGCAACT GGG (reversed) Intergenic