ID: 1155400116

View in Genome Browser
Species Human (GRCh38)
Location 18:25429003-25429025
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155400116_1155400122 2 Left 1155400116 18:25429003-25429025 CCAGTTGCCACCAACTGAAGAGA No data
Right 1155400122 18:25429028-25429050 CTAGGGATGAATCTCTGTGTGGG No data
1155400116_1155400121 1 Left 1155400116 18:25429003-25429025 CCAGTTGCCACCAACTGAAGAGA No data
Right 1155400121 18:25429027-25429049 TCTAGGGATGAATCTCTGTGTGG No data
1155400116_1155400123 6 Left 1155400116 18:25429003-25429025 CCAGTTGCCACCAACTGAAGAGA No data
Right 1155400123 18:25429032-25429054 GGATGAATCTCTGTGTGGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155400116 Original CRISPR TCTCTTCAGTTGGTGGCAAC TGG (reversed) Intergenic