ID: 1155400123

View in Genome Browser
Species Human (GRCh38)
Location 18:25429032-25429054
Sequence GGATGAATCTCTGTGTGGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155400116_1155400123 6 Left 1155400116 18:25429003-25429025 CCAGTTGCCACCAACTGAAGAGA No data
Right 1155400123 18:25429032-25429054 GGATGAATCTCTGTGTGGGTAGG No data
1155400113_1155400123 30 Left 1155400113 18:25428979-25429001 CCCAAAGCAGACACACTCTGCAA No data
Right 1155400123 18:25429032-25429054 GGATGAATCTCTGTGTGGGTAGG No data
1155400115_1155400123 7 Left 1155400115 18:25429002-25429024 CCCAGTTGCCACCAACTGAAGAG No data
Right 1155400123 18:25429032-25429054 GGATGAATCTCTGTGTGGGTAGG No data
1155400114_1155400123 29 Left 1155400114 18:25428980-25429002 CCAAAGCAGACACACTCTGCAAC No data
Right 1155400123 18:25429032-25429054 GGATGAATCTCTGTGTGGGTAGG No data
1155400120_1155400123 -4 Left 1155400120 18:25429013-25429035 CCAACTGAAGAGATTCTAGGGAT No data
Right 1155400123 18:25429032-25429054 GGATGAATCTCTGTGTGGGTAGG No data
1155400117_1155400123 -1 Left 1155400117 18:25429010-25429032 CCACCAACTGAAGAGATTCTAGG No data
Right 1155400123 18:25429032-25429054 GGATGAATCTCTGTGTGGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155400123 Original CRISPR GGATGAATCTCTGTGTGGGT AGG Intergenic