ID: 1155400351

View in Genome Browser
Species Human (GRCh38)
Location 18:25432194-25432216
Sequence GAAATGTACAGAAACGTATC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155400346_1155400351 24 Left 1155400346 18:25432147-25432169 CCAATGGCAAAAGACGGGAAAAT No data
Right 1155400351 18:25432194-25432216 GAAATGTACAGAAACGTATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155400351 Original CRISPR GAAATGTACAGAAACGTATC AGG Intergenic
No off target data available for this crispr