ID: 1155400819

View in Genome Browser
Species Human (GRCh38)
Location 18:25437347-25437369
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155400819_1155400824 22 Left 1155400819 18:25437347-25437369 CCACTTAAACTCCTACATACCTC No data
Right 1155400824 18:25437392-25437414 CAAATGTCCAATCTGGTTTAAGG No data
1155400819_1155400823 15 Left 1155400819 18:25437347-25437369 CCACTTAAACTCCTACATACCTC No data
Right 1155400823 18:25437385-25437407 ATATTAACAAATGTCCAATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155400819 Original CRISPR GAGGTATGTAGGAGTTTAAG TGG (reversed) Intergenic
No off target data available for this crispr