ID: 1155400823

View in Genome Browser
Species Human (GRCh38)
Location 18:25437385-25437407
Sequence ATATTAACAAATGTCCAATC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155400819_1155400823 15 Left 1155400819 18:25437347-25437369 CCACTTAAACTCCTACATACCTC No data
Right 1155400823 18:25437385-25437407 ATATTAACAAATGTCCAATCTGG No data
1155400821_1155400823 4 Left 1155400821 18:25437358-25437380 CCTACATACCTCTGGCTAGAGAG No data
Right 1155400823 18:25437385-25437407 ATATTAACAAATGTCCAATCTGG No data
1155400822_1155400823 -4 Left 1155400822 18:25437366-25437388 CCTCTGGCTAGAGAGAAAGATAT No data
Right 1155400823 18:25437385-25437407 ATATTAACAAATGTCCAATCTGG No data
1155400818_1155400823 28 Left 1155400818 18:25437334-25437356 CCACGCTTCTATTCCACTTAAAC No data
Right 1155400823 18:25437385-25437407 ATATTAACAAATGTCCAATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155400823 Original CRISPR ATATTAACAAATGTCCAATC TGG Intergenic
No off target data available for this crispr