ID: 1155400824

View in Genome Browser
Species Human (GRCh38)
Location 18:25437392-25437414
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155400819_1155400824 22 Left 1155400819 18:25437347-25437369 CCACTTAAACTCCTACATACCTC No data
Right 1155400824 18:25437392-25437414 CAAATGTCCAATCTGGTTTAAGG No data
1155400821_1155400824 11 Left 1155400821 18:25437358-25437380 CCTACATACCTCTGGCTAGAGAG No data
Right 1155400824 18:25437392-25437414 CAAATGTCCAATCTGGTTTAAGG No data
1155400822_1155400824 3 Left 1155400822 18:25437366-25437388 CCTCTGGCTAGAGAGAAAGATAT No data
Right 1155400824 18:25437392-25437414 CAAATGTCCAATCTGGTTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155400824 Original CRISPR CAAATGTCCAATCTGGTTTA AGG Intergenic