ID: 1155402780

View in Genome Browser
Species Human (GRCh38)
Location 18:25457370-25457392
Sequence AATGACATGCAGAAGGAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155402777_1155402780 -10 Left 1155402777 18:25457357-25457379 CCAGAATTCTGATAATGACATGC No data
Right 1155402780 18:25457370-25457392 AATGACATGCAGAAGGAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155402780 Original CRISPR AATGACATGCAGAAGGAGCA GGG Intergenic
No off target data available for this crispr