ID: 1155403166

View in Genome Browser
Species Human (GRCh38)
Location 18:25460525-25460547
Sequence TTGCAGAAGCAGAAAGAGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155403161_1155403166 8 Left 1155403161 18:25460494-25460516 CCCTCTCCCTTTGCAAGATGAAG No data
Right 1155403166 18:25460525-25460547 TTGCAGAAGCAGAAAGAGAATGG No data
1155403165_1155403166 1 Left 1155403165 18:25460501-25460523 CCTTTGCAAGATGAAGGTTCAAC No data
Right 1155403166 18:25460525-25460547 TTGCAGAAGCAGAAAGAGAATGG No data
1155403162_1155403166 7 Left 1155403162 18:25460495-25460517 CCTCTCCCTTTGCAAGATGAAGG No data
Right 1155403166 18:25460525-25460547 TTGCAGAAGCAGAAAGAGAATGG No data
1155403164_1155403166 2 Left 1155403164 18:25460500-25460522 CCCTTTGCAAGATGAAGGTTCAA No data
Right 1155403166 18:25460525-25460547 TTGCAGAAGCAGAAAGAGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155403166 Original CRISPR TTGCAGAAGCAGAAAGAGAA TGG Intergenic
No off target data available for this crispr