ID: 1155411099

View in Genome Browser
Species Human (GRCh38)
Location 18:25546099-25546121
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155411099_1155411100 5 Left 1155411099 18:25546099-25546121 CCAGATATATAAAGCACATATTA No data
Right 1155411100 18:25546127-25546149 GCTAAAGAAAGAGATAGAGCTGG No data
1155411099_1155411102 14 Left 1155411099 18:25546099-25546121 CCAGATATATAAAGCACATATTA No data
Right 1155411102 18:25546136-25546158 AGAGATAGAGCTGGGCACAGTGG No data
1155411099_1155411101 6 Left 1155411099 18:25546099-25546121 CCAGATATATAAAGCACATATTA No data
Right 1155411101 18:25546128-25546150 CTAAAGAAAGAGATAGAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155411099 Original CRISPR TAATATGTGCTTTATATATC TGG (reversed) Intergenic
No off target data available for this crispr