ID: 1155411101

View in Genome Browser
Species Human (GRCh38)
Location 18:25546128-25546150
Sequence CTAAAGAAAGAGATAGAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155411096_1155411101 22 Left 1155411096 18:25546083-25546105 CCCAATACTGGCGCACCCAGATA No data
Right 1155411101 18:25546128-25546150 CTAAAGAAAGAGATAGAGCTGGG No data
1155411099_1155411101 6 Left 1155411099 18:25546099-25546121 CCAGATATATAAAGCACATATTA No data
Right 1155411101 18:25546128-25546150 CTAAAGAAAGAGATAGAGCTGGG No data
1155411097_1155411101 21 Left 1155411097 18:25546084-25546106 CCAATACTGGCGCACCCAGATAT No data
Right 1155411101 18:25546128-25546150 CTAAAGAAAGAGATAGAGCTGGG No data
1155411098_1155411101 7 Left 1155411098 18:25546098-25546120 CCCAGATATATAAAGCACATATT No data
Right 1155411101 18:25546128-25546150 CTAAAGAAAGAGATAGAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155411101 Original CRISPR CTAAAGAAAGAGATAGAGCT GGG Intergenic
No off target data available for this crispr