ID: 1155413127

View in Genome Browser
Species Human (GRCh38)
Location 18:25567806-25567828
Sequence TACCTAGAGTGATCTAGTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155413127_1155413130 6 Left 1155413127 18:25567806-25567828 CCTGGACTAGATCACTCTAGGTA No data
Right 1155413130 18:25567835-25567857 AGGTAAGAAATGAGAAATTTGGG No data
1155413127_1155413129 5 Left 1155413127 18:25567806-25567828 CCTGGACTAGATCACTCTAGGTA No data
Right 1155413129 18:25567834-25567856 GAGGTAAGAAATGAGAAATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155413127 Original CRISPR TACCTAGAGTGATCTAGTCC AGG (reversed) Intergenic
No off target data available for this crispr