ID: 1155413548

View in Genome Browser
Species Human (GRCh38)
Location 18:25571760-25571782
Sequence GTGCCATCCATGGCTAAAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155413548_1155413562 24 Left 1155413548 18:25571760-25571782 CCCCTTTTAGCCATGGATGGCAC No data
Right 1155413562 18:25571807-25571829 CCAAGGCTGCACATGGCAGAGGG No data
1155413548_1155413560 23 Left 1155413548 18:25571760-25571782 CCCCTTTTAGCCATGGATGGCAC No data
Right 1155413560 18:25571806-25571828 CCCAAGGCTGCACATGGCAGAGG 0: 2
1: 15
2: 139
3: 441
4: 1534
1155413548_1155413563 25 Left 1155413548 18:25571760-25571782 CCCCTTTTAGCCATGGATGGCAC No data
Right 1155413563 18:25571808-25571830 CAAGGCTGCACATGGCAGAGGGG No data
1155413548_1155413556 7 Left 1155413548 18:25571760-25571782 CCCCTTTTAGCCATGGATGGCAC No data
Right 1155413556 18:25571790-25571812 ACAGAGGACACCAAATCCCAAGG No data
1155413548_1155413555 -9 Left 1155413548 18:25571760-25571782 CCCCTTTTAGCCATGGATGGCAC No data
Right 1155413555 18:25571774-25571796 GGATGGCACGGCTGGGACAGAGG No data
1155413548_1155413558 17 Left 1155413548 18:25571760-25571782 CCCCTTTTAGCCATGGATGGCAC No data
Right 1155413558 18:25571800-25571822 CCAAATCCCAAGGCTGCACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155413548 Original CRISPR GTGCCATCCATGGCTAAAAG GGG (reversed) Intergenic
No off target data available for this crispr