ID: 1155414535

View in Genome Browser
Species Human (GRCh38)
Location 18:25582488-25582510
Sequence ATTTTGACCAGAGGGATAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155414535_1155414543 16 Left 1155414535 18:25582488-25582510 CCTTTTATCCCTCTGGTCAAAAT No data
Right 1155414543 18:25582527-25582549 TGCTTTGTTTTGGAGGGTGGTGG No data
1155414535_1155414541 10 Left 1155414535 18:25582488-25582510 CCTTTTATCCCTCTGGTCAAAAT No data
Right 1155414541 18:25582521-25582543 TTGCTTTGCTTTGTTTTGGAGGG No data
1155414535_1155414544 17 Left 1155414535 18:25582488-25582510 CCTTTTATCCCTCTGGTCAAAAT No data
Right 1155414544 18:25582528-25582550 GCTTTGTTTTGGAGGGTGGTGGG No data
1155414535_1155414540 9 Left 1155414535 18:25582488-25582510 CCTTTTATCCCTCTGGTCAAAAT No data
Right 1155414540 18:25582520-25582542 GTTGCTTTGCTTTGTTTTGGAGG No data
1155414535_1155414539 6 Left 1155414535 18:25582488-25582510 CCTTTTATCCCTCTGGTCAAAAT No data
Right 1155414539 18:25582517-25582539 GTCGTTGCTTTGCTTTGTTTTGG No data
1155414535_1155414542 13 Left 1155414535 18:25582488-25582510 CCTTTTATCCCTCTGGTCAAAAT No data
Right 1155414542 18:25582524-25582546 CTTTGCTTTGTTTTGGAGGGTGG No data
1155414535_1155414545 18 Left 1155414535 18:25582488-25582510 CCTTTTATCCCTCTGGTCAAAAT No data
Right 1155414545 18:25582529-25582551 CTTTGTTTTGGAGGGTGGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155414535 Original CRISPR ATTTTGACCAGAGGGATAAA AGG (reversed) Intergenic
No off target data available for this crispr