ID: 1155416694

View in Genome Browser
Species Human (GRCh38)
Location 18:25606206-25606228
Sequence CTGTTGATAAGGAATGACGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155416694_1155416697 7 Left 1155416694 18:25606206-25606228 CCCTCGTCATTCCTTATCAACAG No data
Right 1155416697 18:25606236-25606258 AACACATGTTATTAAACATCTGG No data
1155416694_1155416698 8 Left 1155416694 18:25606206-25606228 CCCTCGTCATTCCTTATCAACAG No data
Right 1155416698 18:25606237-25606259 ACACATGTTATTAAACATCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155416694 Original CRISPR CTGTTGATAAGGAATGACGA GGG (reversed) Intergenic
No off target data available for this crispr