ID: 1155416698

View in Genome Browser
Species Human (GRCh38)
Location 18:25606237-25606259
Sequence ACACATGTTATTAAACATCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155416693_1155416698 24 Left 1155416693 18:25606190-25606212 CCATGATTTCTCTAAACCCTCGT No data
Right 1155416698 18:25606237-25606259 ACACATGTTATTAAACATCTGGG No data
1155416696_1155416698 -3 Left 1155416696 18:25606217-25606239 CCTTATCAACAGCTTCAAAAACA No data
Right 1155416698 18:25606237-25606259 ACACATGTTATTAAACATCTGGG No data
1155416694_1155416698 8 Left 1155416694 18:25606206-25606228 CCCTCGTCATTCCTTATCAACAG No data
Right 1155416698 18:25606237-25606259 ACACATGTTATTAAACATCTGGG No data
1155416692_1155416698 28 Left 1155416692 18:25606186-25606208 CCTTCCATGATTTCTCTAAACCC No data
Right 1155416698 18:25606237-25606259 ACACATGTTATTAAACATCTGGG No data
1155416691_1155416698 29 Left 1155416691 18:25606185-25606207 CCCTTCCATGATTTCTCTAAACC No data
Right 1155416698 18:25606237-25606259 ACACATGTTATTAAACATCTGGG No data
1155416695_1155416698 7 Left 1155416695 18:25606207-25606229 CCTCGTCATTCCTTATCAACAGC No data
Right 1155416698 18:25606237-25606259 ACACATGTTATTAAACATCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155416698 Original CRISPR ACACATGTTATTAAACATCT GGG Intergenic
No off target data available for this crispr