ID: 1155417608

View in Genome Browser
Species Human (GRCh38)
Location 18:25616788-25616810
Sequence GAGAGAGTCAGCTGAGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155417605_1155417608 3 Left 1155417605 18:25616762-25616784 CCATGGTACAGAAAGAAAGTGCC No data
Right 1155417608 18:25616788-25616810 GAGAGAGTCAGCTGAGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155417608 Original CRISPR GAGAGAGTCAGCTGAGTGGA AGG Intergenic
No off target data available for this crispr