ID: 1155421156

View in Genome Browser
Species Human (GRCh38)
Location 18:25657956-25657978
Sequence TGCCACGTGATCTCACATAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155421156_1155421157 -4 Left 1155421156 18:25657956-25657978 CCTATATGTGAGATCACGTGGCA No data
Right 1155421157 18:25657975-25657997 GGCATTTGTCTTTCTGTGTCTGG 0: 8
1: 143
2: 832
3: 2480
4: 5151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155421156 Original CRISPR TGCCACGTGATCTCACATAT AGG (reversed) Intergenic
No off target data available for this crispr