ID: 1155432909

View in Genome Browser
Species Human (GRCh38)
Location 18:25780276-25780298
Sequence CGTCACATGGTCAAGCAGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155432907_1155432909 -3 Left 1155432907 18:25780256-25780278 CCAGGCAACGATTTCAGAATCGT No data
Right 1155432909 18:25780276-25780298 CGTCACATGGTCAAGCAGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155432909 Original CRISPR CGTCACATGGTCAAGCAGTA AGG Intergenic
No off target data available for this crispr