ID: 1155433369

View in Genome Browser
Species Human (GRCh38)
Location 18:25785615-25785637
Sequence CGGCATCAGCAGAGGCAGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155433369_1155433380 9 Left 1155433369 18:25785615-25785637 CCCCTCTGCCTCTGCTGATGCCG No data
Right 1155433380 18:25785647-25785669 TCAGGTGGCCTTCGGGATGCAGG No data
1155433369_1155433374 -9 Left 1155433369 18:25785615-25785637 CCCCTCTGCCTCTGCTGATGCCG No data
Right 1155433374 18:25785629-25785651 CTGATGCCGGCTGCTCCTTCAGG No data
1155433369_1155433375 -6 Left 1155433369 18:25785615-25785637 CCCCTCTGCCTCTGCTGATGCCG No data
Right 1155433375 18:25785632-25785654 ATGCCGGCTGCTCCTTCAGGTGG No data
1155433369_1155433377 1 Left 1155433369 18:25785615-25785637 CCCCTCTGCCTCTGCTGATGCCG No data
Right 1155433377 18:25785639-25785661 CTGCTCCTTCAGGTGGCCTTCGG No data
1155433369_1155433378 2 Left 1155433369 18:25785615-25785637 CCCCTCTGCCTCTGCTGATGCCG No data
Right 1155433378 18:25785640-25785662 TGCTCCTTCAGGTGGCCTTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155433369 Original CRISPR CGGCATCAGCAGAGGCAGAG GGG (reversed) Intergenic
No off target data available for this crispr