ID: 1155436672

View in Genome Browser
Species Human (GRCh38)
Location 18:25819848-25819870
Sequence CCTAGTGGGGAAAATGAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155436672_1155436679 27 Left 1155436672 18:25819848-25819870 CCTGCTTCATTTTCCCCACTAGG No data
Right 1155436679 18:25819898-25819920 TTCCCTCCCAAGAGCTCTCTGGG No data
1155436672_1155436678 26 Left 1155436672 18:25819848-25819870 CCTGCTTCATTTTCCCCACTAGG No data
Right 1155436678 18:25819897-25819919 GTTCCCTCCCAAGAGCTCTCTGG No data
1155436672_1155436680 28 Left 1155436672 18:25819848-25819870 CCTGCTTCATTTTCCCCACTAGG No data
Right 1155436680 18:25819899-25819921 TCCCTCCCAAGAGCTCTCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155436672 Original CRISPR CCTAGTGGGGAAAATGAAGC AGG (reversed) Intergenic