ID: 1155436674

View in Genome Browser
Species Human (GRCh38)
Location 18:25819861-25819883
Sequence CTGCTTGCTCTTTCCTAGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155436674_1155436686 25 Left 1155436674 18:25819861-25819883 CCCCACTAGGAAAGAGCAAGCAG No data
Right 1155436686 18:25819909-25819931 GAGCTCTCTGGGGAATAAGGAGG No data
1155436674_1155436685 22 Left 1155436674 18:25819861-25819883 CCCCACTAGGAAAGAGCAAGCAG No data
Right 1155436685 18:25819906-25819928 CAAGAGCTCTCTGGGGAATAAGG No data
1155436674_1155436679 14 Left 1155436674 18:25819861-25819883 CCCCACTAGGAAAGAGCAAGCAG No data
Right 1155436679 18:25819898-25819920 TTCCCTCCCAAGAGCTCTCTGGG No data
1155436674_1155436678 13 Left 1155436674 18:25819861-25819883 CCCCACTAGGAAAGAGCAAGCAG No data
Right 1155436678 18:25819897-25819919 GTTCCCTCCCAAGAGCTCTCTGG No data
1155436674_1155436680 15 Left 1155436674 18:25819861-25819883 CCCCACTAGGAAAGAGCAAGCAG No data
Right 1155436680 18:25819899-25819921 TCCCTCCCAAGAGCTCTCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155436674 Original CRISPR CTGCTTGCTCTTTCCTAGTG GGG (reversed) Intergenic