ID: 1155436676

View in Genome Browser
Species Human (GRCh38)
Location 18:25819863-25819885
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155436676_1155436679 12 Left 1155436676 18:25819863-25819885 CCACTAGGAAAGAGCAAGCAGCA No data
Right 1155436679 18:25819898-25819920 TTCCCTCCCAAGAGCTCTCTGGG No data
1155436676_1155436678 11 Left 1155436676 18:25819863-25819885 CCACTAGGAAAGAGCAAGCAGCA No data
Right 1155436678 18:25819897-25819919 GTTCCCTCCCAAGAGCTCTCTGG No data
1155436676_1155436686 23 Left 1155436676 18:25819863-25819885 CCACTAGGAAAGAGCAAGCAGCA No data
Right 1155436686 18:25819909-25819931 GAGCTCTCTGGGGAATAAGGAGG No data
1155436676_1155436685 20 Left 1155436676 18:25819863-25819885 CCACTAGGAAAGAGCAAGCAGCA No data
Right 1155436685 18:25819906-25819928 CAAGAGCTCTCTGGGGAATAAGG No data
1155436676_1155436680 13 Left 1155436676 18:25819863-25819885 CCACTAGGAAAGAGCAAGCAGCA No data
Right 1155436680 18:25819899-25819921 TCCCTCCCAAGAGCTCTCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155436676 Original CRISPR TGCTGCTTGCTCTTTCCTAG TGG (reversed) Intergenic