ID: 1155436678

View in Genome Browser
Species Human (GRCh38)
Location 18:25819897-25819919
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155436675_1155436678 12 Left 1155436675 18:25819862-25819884 CCCACTAGGAAAGAGCAAGCAGC No data
Right 1155436678 18:25819897-25819919 GTTCCCTCCCAAGAGCTCTCTGG No data
1155436672_1155436678 26 Left 1155436672 18:25819848-25819870 CCTGCTTCATTTTCCCCACTAGG No data
Right 1155436678 18:25819897-25819919 GTTCCCTCCCAAGAGCTCTCTGG No data
1155436674_1155436678 13 Left 1155436674 18:25819861-25819883 CCCCACTAGGAAAGAGCAAGCAG No data
Right 1155436678 18:25819897-25819919 GTTCCCTCCCAAGAGCTCTCTGG No data
1155436676_1155436678 11 Left 1155436676 18:25819863-25819885 CCACTAGGAAAGAGCAAGCAGCA No data
Right 1155436678 18:25819897-25819919 GTTCCCTCCCAAGAGCTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155436678 Original CRISPR GTTCCCTCCCAAGAGCTCTC TGG Intergenic