ID: 1155436686

View in Genome Browser
Species Human (GRCh38)
Location 18:25819909-25819931
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155436674_1155436686 25 Left 1155436674 18:25819861-25819883 CCCCACTAGGAAAGAGCAAGCAG No data
Right 1155436686 18:25819909-25819931 GAGCTCTCTGGGGAATAAGGAGG No data
1155436675_1155436686 24 Left 1155436675 18:25819862-25819884 CCCACTAGGAAAGAGCAAGCAGC No data
Right 1155436686 18:25819909-25819931 GAGCTCTCTGGGGAATAAGGAGG No data
1155436676_1155436686 23 Left 1155436676 18:25819863-25819885 CCACTAGGAAAGAGCAAGCAGCA No data
Right 1155436686 18:25819909-25819931 GAGCTCTCTGGGGAATAAGGAGG No data
1155436677_1155436686 -4 Left 1155436677 18:25819890-25819912 CCTCTCTGTTCCCTCCCAAGAGC No data
Right 1155436686 18:25819909-25819931 GAGCTCTCTGGGGAATAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155436686 Original CRISPR GAGCTCTCTGGGGAATAAGG AGG Intergenic
No off target data available for this crispr