ID: 1155437111

View in Genome Browser
Species Human (GRCh38)
Location 18:25825049-25825071
Sequence GCAACCTTGGAAACTTCTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155437109_1155437111 1 Left 1155437109 18:25825025-25825047 CCAATTAGACATTTTTACACGTC No data
Right 1155437111 18:25825049-25825071 GCAACCTTGGAAACTTCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155437111 Original CRISPR GCAACCTTGGAAACTTCTCC TGG Intergenic