ID: 1155438166

View in Genome Browser
Species Human (GRCh38)
Location 18:25834254-25834276
Sequence CAGAGTTCCCAGGGCGTTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155438166_1155438171 -9 Left 1155438166 18:25834254-25834276 CCCTGAACGCCCTGGGAACTCTG No data
Right 1155438171 18:25834268-25834290 GGAACTCTGCAGAAGCTGTTGGG No data
1155438166_1155438172 8 Left 1155438166 18:25834254-25834276 CCCTGAACGCCCTGGGAACTCTG No data
Right 1155438172 18:25834285-25834307 GTTGGGCAAAAGCTCCCACCTGG No data
1155438166_1155438170 -10 Left 1155438166 18:25834254-25834276 CCCTGAACGCCCTGGGAACTCTG No data
Right 1155438170 18:25834267-25834289 GGGAACTCTGCAGAAGCTGTTGG No data
1155438166_1155438175 25 Left 1155438166 18:25834254-25834276 CCCTGAACGCCCTGGGAACTCTG No data
Right 1155438175 18:25834302-25834324 ACCTGGTTGTCACCCTTTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155438166 Original CRISPR CAGAGTTCCCAGGGCGTTCA GGG (reversed) Intergenic
No off target data available for this crispr