ID: 1155440119

View in Genome Browser
Species Human (GRCh38)
Location 18:25853514-25853536
Sequence GGCAAGGTCTCCCCTACACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155440114_1155440119 19 Left 1155440114 18:25853472-25853494 CCTCTGACAATCACTTAGGAATA No data
Right 1155440119 18:25853514-25853536 GGCAAGGTCTCCCCTACACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155440119 Original CRISPR GGCAAGGTCTCCCCTACACA GGG Intergenic
No off target data available for this crispr