ID: 1155442923

View in Genome Browser
Species Human (GRCh38)
Location 18:25880896-25880918
Sequence GGCCAAAGGCTGACATGACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155442914_1155442923 19 Left 1155442914 18:25880854-25880876 CCTTGAAGAATGCAGCACAGCCC No data
Right 1155442923 18:25880896-25880918 GGCCAAAGGCTGACATGACCAGG No data
1155442918_1155442923 -1 Left 1155442918 18:25880874-25880896 CCCATGGCATCCTCTGGGAAATG No data
Right 1155442923 18:25880896-25880918 GGCCAAAGGCTGACATGACCAGG No data
1155442919_1155442923 -2 Left 1155442919 18:25880875-25880897 CCATGGCATCCTCTGGGAAATGG No data
Right 1155442923 18:25880896-25880918 GGCCAAAGGCTGACATGACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155442923 Original CRISPR GGCCAAAGGCTGACATGACC AGG Intergenic
No off target data available for this crispr