ID: 1155455847

View in Genome Browser
Species Human (GRCh38)
Location 18:26012334-26012356
Sequence CCACCCAAAACAATAATGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155455839_1155455847 27 Left 1155455839 18:26012284-26012306 CCAAGCTGCAAAGGAGGATGTTA No data
Right 1155455847 18:26012334-26012356 CCACCCAAAACAATAATGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155455847 Original CRISPR CCACCCAAAACAATAATGGA GGG Intergenic
No off target data available for this crispr