ID: 1155456983

View in Genome Browser
Species Human (GRCh38)
Location 18:26028049-26028071
Sequence CTGATTAAGGACTTGTATCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 306
Summary {0: 1, 1: 1, 2: 7, 3: 61, 4: 236}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155456983 Original CRISPR CTGATTAAGGACTTGTATCT AGG Intronic
900567876 1:3343362-3343384 ACGACTAAGGACTTGTATCTAGG - Intronic
903107688 1:21098221-21098243 AAGATAAAGGATTTGTATCTAGG + Intronic
905136134 1:35801677-35801699 CTGATAAGGGACTGGTATCAAGG + Intergenic
905167732 1:36092872-36092894 CTGCTTAAGGAGTTGAATCTGGG + Intronic
905333118 1:37222323-37222345 CTGATAAAGGACTAGTATCCAGG + Intergenic
906359816 1:45144919-45144941 CCAATAAAGGACTTGCATCTAGG + Intronic
906661071 1:47582562-47582584 CTGACAAGGGACTTGTACCTAGG - Intergenic
906822741 1:48946480-48946502 TTGCTTAAGGACTTGTACCTGGG - Intronic
906986936 1:50692956-50692978 TTGATAAGAGACTTGTATCTAGG - Intronic
907595400 1:55715109-55715131 CTCCTTATGGTCTTGTATCTAGG - Intergenic
907657629 1:56360233-56360255 GTGGTTAAGGACGTGTCTCTGGG + Intergenic
909462642 1:75935968-75935990 CTTATTAACAACTTGTAGCTGGG - Intergenic
911037254 1:93564201-93564223 CTGATAAAGGACTTACATCTAGG - Intronic
911249988 1:95564575-95564597 CTGATAAAGAACTTTTATCCAGG - Intergenic
912162826 1:107007065-107007087 CCAATTAAGGACTTGTTTCTGGG - Intergenic
913500012 1:119463572-119463594 TTGATAAAGGACTTATATCCAGG + Intergenic
913558094 1:119989575-119989597 CTGATAAGAGACTTGTATTTAGG + Intronic
913639749 1:120800877-120800899 CTGATAAGAGACTTGTATTTAGG - Intergenic
914278728 1:146149464-146149486 CTGATAAGAGACTTGTATTTAGG + Intronic
914539775 1:148600406-148600428 CTGATAAGAGACTTGTATTTAGG + Intronic
914626899 1:149471212-149471234 CTGATAAGAGACTTGTATTTAGG - Intergenic
917109426 1:171530220-171530242 CTGACGAAGGACTTGTAGCTGGG + Intronic
918380501 1:183949834-183949856 CTGATAAAGGACTTGCATCCAGG + Intronic
921453385 1:215337155-215337177 CTGCTTAGGGACTTTTATCAAGG + Intergenic
921563102 1:216682076-216682098 CTTGTTAAGAACTTGTATTTCGG - Intronic
924371751 1:243358193-243358215 CTGATAAGAGACTTGTATCTAGG + Intronic
1063754766 10:8995127-8995149 ATGATTACGGACATGTATCCAGG + Intergenic
1064404386 10:15048164-15048186 CTGATTGGGTACTTGGATCTTGG + Intronic
1064436508 10:15315573-15315595 CAGACTTAGCACTTGTATCTGGG + Intronic
1065481322 10:26197112-26197134 CTGATTAAGGCCTTCTTCCTTGG - Intronic
1066318302 10:34272409-34272431 CTGACAAAGGACTTATATCCAGG + Intronic
1066450535 10:35524277-35524299 CTGATGAAGAAATTGTAACTGGG - Intronic
1066708250 10:38204054-38204076 CTGATTCAGGCCTTGGCTCTTGG + Intergenic
1068164709 10:53313976-53313998 CTGATGAAGGACTTGTATCCAGG - Intergenic
1068824917 10:61425545-61425567 TTGATAAAGGACTTGTATCAAGG + Intronic
1069463900 10:68621022-68621044 TTGATAAAGGACTTGTGTGTAGG - Intronic
1070127481 10:73633900-73633922 CTGTTGAAGGACTTATATTTGGG + Exonic
1070542625 10:77427483-77427505 CTGATTCAGTATCTGTATCTGGG - Intronic
1070630820 10:78083182-78083204 CAGAGAAAGGACTTGAATCTAGG - Intergenic
1071839330 10:89452837-89452859 CTGATTGAGGACGTGCATCAGGG - Intronic
1074585472 10:114764188-114764210 CTCATCAAAGACTTGTAACTTGG - Intergenic
1075462581 10:122627793-122627815 CTCATAAGGGACTTGTATCTAGG + Intronic
1077617410 11:3687274-3687296 CTGATAGAGAACTTGTATCCAGG - Intronic
1077625193 11:3765086-3765108 GTGATATAGGACTTGTATCCAGG - Intronic
1077924628 11:6668519-6668541 CTGATAAGGAACTTGTATCTAGG - Intergenic
1078309318 11:10223198-10223220 CTCATTAAGGAATTGAATATCGG - Intronic
1078404987 11:11062730-11062752 CTGATGAAGGACTTACATTTTGG + Intergenic
1084401361 11:68945439-68945461 CTGATAAAAGACTTCTATCCAGG - Intergenic
1085138075 11:74112557-74112579 CTGATAAGGGGCTTGTATCTAGG + Intronic
1085169088 11:74433097-74433119 CTGATAAAGGAATAGTATCCAGG + Intergenic
1085913255 11:80853691-80853713 CTGATTAATTACTTTTATTTTGG - Intergenic
1086381614 11:86261087-86261109 CTGATTGAGGATTTGAATTTTGG - Intronic
1088549523 11:110997536-110997558 CTAACAAAGGACTTGTATCTAGG + Intergenic
1089776230 11:120838201-120838223 CTGAGTCAGGACTTGACTCTGGG - Intronic
1090272256 11:125395815-125395837 CTGACAAAGGACTTGTATCTAGG - Intronic
1090410559 11:126506357-126506379 CTGGTAAAGGACTTGTATCCTGG + Intronic
1090634852 11:128684518-128684540 CTTGTTAAGGAGTTGTTTCTGGG - Intergenic
1090873486 11:130768552-130768574 CTGGTTAAGGACATGTACCGTGG - Intergenic
1092024317 12:5228070-5228092 CTCATTTAGGTCTTGTCTCTGGG - Intergenic
1092771197 12:11898534-11898556 TTGATAAAGAACTTGTATCCAGG + Intergenic
1094472350 12:30815224-30815246 CTGACAAAGGACTTGCATCTAGG - Intergenic
1094497345 12:30996576-30996598 ATAATAAAGGAATTGTATCTAGG + Exonic
1095578102 12:43762515-43762537 TTAATTAAGAAATTGTATCTAGG - Intronic
1095921515 12:47536124-47536146 CTGATTAAGGACTTGCAACATGG + Intergenic
1096285311 12:50294853-50294875 CTGATAAAGGCCTTGTATCCAGG - Intergenic
1101257741 12:102996227-102996249 CTGATAAAAGACAAGTATCTAGG - Intergenic
1102925781 12:116825114-116825136 CTTCTTAAGGTCCTGTATCTGGG + Intronic
1103421949 12:120793030-120793052 CTGATAAGGGACTTGTGTCTAGG + Intronic
1105249178 13:18681375-18681397 CTTATTAAGGTCTTGTTGCTGGG - Intergenic
1106791552 13:33160541-33160563 CTGACAAAGGACTCATATCTAGG + Intronic
1107297604 13:38928130-38928152 CTGATAAGGGACTTATATCTAGG + Intergenic
1107766593 13:43741629-43741651 CTGATAAGGGACTTGTATATTGG - Intronic
1108871613 13:54993699-54993721 CTGATTAAAGCCTTCTTTCTTGG + Intergenic
1110207697 13:72935921-72935943 CTGATAAATGACTTGTATTTAGG - Intronic
1111290496 13:86162426-86162448 CTGATTAAAGCCTTTTCTCTTGG - Intergenic
1112673171 13:101665460-101665482 ATTATTAACCACTTGTATCTAGG + Intronic
1114788639 14:25629952-25629974 CTGAGCAAGGAGTAGTATCTTGG - Intergenic
1115077616 14:29410685-29410707 CTGATTAATGACTTACATTTTGG + Intergenic
1115161151 14:30396056-30396078 CTGACAAAGGACTTGTATCTAGG - Intergenic
1115925003 14:38422962-38422984 CAGATTAAAGACTTTTATCTAGG - Intergenic
1116327558 14:43550532-43550554 CTGATAAGGGACTTGTATCCAGG + Intergenic
1116714503 14:48410604-48410626 TGGATTAAAGACTTGTATGTTGG - Intergenic
1117750719 14:58920651-58920673 TTGACAAAGGACTTCTATCTAGG + Intergenic
1119257944 14:73215604-73215626 CTGTTAAAGGACTTGTATTTAGG + Intronic
1119277948 14:73377335-73377357 CTGATAAAGGACTATTATCCAGG + Intronic
1119630081 14:76222654-76222676 CTGTTTAAGAAGTTGAATCTGGG + Intronic
1119843514 14:77810996-77811018 CTGATTAGGGACCTGTGTCTCGG + Intronic
1122344293 14:101048975-101048997 CTGAAGCAGGTCTTGTATCTGGG - Intergenic
1122392217 14:101397657-101397679 CAGAATAAAGACTTATATCTTGG + Intergenic
1122727148 14:103764466-103764488 CTGATAAAGGACTCATATCTGGG - Intronic
1124178095 15:27445572-27445594 CTGATAAGGGACTTCTATATAGG - Intronic
1124578628 15:30931330-30931352 CTGATAAAGGACTTGTATCCAGG - Intronic
1124683843 15:31761287-31761309 CTGATAAGGGACTTGTATACAGG + Intronic
1125043128 15:35214907-35214929 CCGATTAAGAAGTTGTATCCAGG - Intergenic
1126269472 15:46797691-46797713 CAGATTAAAGACTTGGATCTAGG + Intergenic
1128586080 15:68851245-68851267 CTGATTATGGACTTGCCCCTAGG - Intronic
1129553812 15:76483602-76483624 CTGATAAAGTATTTGTATCCAGG + Intronic
1130331056 15:82922749-82922771 CTGAGTGAGGACTTGGATTTTGG - Intronic
1130839388 15:87683514-87683536 CTGGTTAATGCCTAGTATCTTGG - Intergenic
1132190636 15:99853580-99853602 CTGATAAAGGACTGGTATTCAGG - Intergenic
1134891859 16:17847983-17848005 CTGAATAAGGCCTTTTTTCTTGG + Intergenic
1135502518 16:23008932-23008954 CTGATTACCCACTTGTTTCTAGG - Intergenic
1135619218 16:23939951-23939973 CTGACAAAGGACTATTATCTAGG + Intronic
1135862240 16:26067274-26067296 CTGATTCAGAACTTCTCTCTAGG - Intronic
1137572236 16:49574420-49574442 CTGATTCAGCAGTTGTATGTGGG + Intronic
1141024329 16:80530220-80530242 CTGACTAAGGACTAGTATCTGGG - Intergenic
1141340228 16:83196537-83196559 CTGAAAAAGGATTAGTATCTAGG + Intronic
1142116876 16:88361592-88361614 CTGACAAAGCACTTGTATCCAGG - Intergenic
1144850052 17:18239540-18239562 ATGCTGAAGTACTTGTATCTGGG - Intronic
1146295574 17:31647507-31647529 CTGATTAAAGCCTTCTACCTTGG + Intergenic
1146477255 17:33172975-33172997 CTGATTAAGGAATGGGATCATGG - Intronic
1146970724 17:37069748-37069770 CTGATAAGGGACTTGAATCCAGG - Intergenic
1147718620 17:42524199-42524221 CTGATAAAGGACTTGTATCTAGG + Intergenic
1149055730 17:52362565-52362587 TTGATTAAGAGCTTGTATCCAGG + Intergenic
1149410350 17:56398719-56398741 CAGAGTAATGACTTGTCTCTTGG - Intronic
1151786382 17:76277040-76277062 CTGATTAAGGAATTGCCTCAAGG + Intronic
1153189774 18:2524884-2524906 CTGATTAAGAACTTTTATTCAGG - Intergenic
1153266113 18:3271284-3271306 TTTATTTAGGACTTGTATATGGG + Intronic
1154093334 18:11385826-11385848 ATGACTAAGTACTTCTATCTGGG + Intergenic
1154439707 18:14377855-14377877 CTTATTAAGGTCTTGTTGCTGGG + Intergenic
1155456983 18:26028049-26028071 CTGATTAAGGACTTGTATCTAGG + Intronic
1155622952 18:27801898-27801920 TGGATTAAAGACTTGAATCTAGG + Intergenic
1156964979 18:43080345-43080367 CAGATAAAGGAGTTGTATCTGGG + Intronic
1156985745 18:43349522-43349544 CACATTAAGGACTTGAATCTGGG - Intergenic
1157352676 18:46903311-46903333 CTGACAAAGGACTACTATCTAGG + Intronic
1158654323 18:59315419-59315441 CTGACAAAGGACTGGAATCTAGG - Intronic
1158835004 18:61321709-61321731 TTGAATAAGGAAGTGTATCTCGG - Intergenic
1159046481 18:63373736-63373758 CTGACAAAGGACTAGTATCCAGG + Intergenic
1159701125 18:71629108-71629130 CTGATAAGGGACTTTTATCCAGG + Intergenic
1163148449 19:15397926-15397948 CTGTTTCAGGGCTTGTGTCTGGG - Intronic
1164149507 19:22538982-22539004 CTAATAAAGGGCTTGTATCCAGG + Intergenic
1164408570 19:27977079-27977101 CTGATTCAGGCCTTGGCTCTTGG + Intergenic
1166627942 19:44377766-44377788 CTGAGAAAGGATTGGTATCTAGG + Intronic
926187687 2:10704032-10704054 CTGACAAAGGACTAGTATCCAGG + Intergenic
926903502 2:17784093-17784115 GTGATAAGGGACTTGTATCTTGG + Exonic
927612140 2:24551347-24551369 CTGATGAAGGACTTGTTTTCAGG - Intronic
928923478 2:36551701-36551723 CTGTGTAAGTACATGTATCTGGG + Intronic
929923344 2:46189271-46189293 CTGATTCAAGAGTTGTTTCTAGG + Intergenic
930654236 2:53992324-53992346 CTGATTAAAAACTTGTCTATAGG - Intronic
934919230 2:98329438-98329460 TTGATAAAGGACTGGTTTCTAGG + Intergenic
935207040 2:100905139-100905161 CTGAGTTAGGACTTGAATCCAGG - Intronic
935752822 2:106252670-106252692 CTGATTCAGGACTTTTCTTTTGG + Intergenic
935877160 2:107522072-107522094 CTGATGAAGGACTGTTACCTAGG - Intergenic
935913241 2:107920211-107920233 CTGATTCAGGACTTTTCTTTTGG + Intergenic
937184432 2:120026839-120026861 CTGATAAGGAACTTGTATCTAGG + Intronic
937430964 2:121837797-121837819 CTGACTAAGCACTTGCAGCTGGG - Intergenic
937938018 2:127261581-127261603 CTGATAAGGGATTTGTATCTAGG + Intronic
938158386 2:128960448-128960470 CTGATTAAAGCCTTCTTTCTTGG - Intergenic
938545577 2:132326806-132326828 CTGAGAAAGGATTTGTATCTAGG - Intergenic
938869348 2:135457646-135457668 CTGATAAGGGACTTGTATCAAGG - Intronic
939037113 2:137146350-137146372 CAGATTAAGGATTTGAAACTCGG - Intronic
940288442 2:152054951-152054973 CTGATAAGGGACTTGTGTCTAGG - Intronic
940938435 2:159527340-159527362 CTGACAAAGGACTCTTATCTAGG - Intronic
941995613 2:171599471-171599493 CTGATAAAGGACTTGTCTCCAGG - Intergenic
942384128 2:175423450-175423472 CTGATCAAGGAGTTGTCTCCTGG + Intergenic
942575098 2:177354975-177354997 TGGATTAAGGACTTAAATCTAGG - Intronic
942910234 2:181234649-181234671 CTGATGAAAGCCATGTATCTGGG + Intergenic
943570037 2:189563638-189563660 CAGATTCAGGACTTGTCTCCGGG + Exonic
944305687 2:198176088-198176110 CTGATGAAGGACTTGTATCCAGG - Intronic
944359367 2:198834501-198834523 CTGACAAAGGAATAGTATCTAGG + Intergenic
944425867 2:199582411-199582433 CTGATTAACCACTTAGATCTGGG + Intergenic
944630787 2:201622009-201622031 CTGATTAAGGACTTGTACAGAGG - Exonic
945045573 2:205778542-205778564 CTCATTAAGGGCTTTTACCTCGG + Intronic
946938114 2:224742814-224742836 CTGATTAATGCCTTTTTTCTTGG + Intergenic
1169566251 20:6856577-6856599 CTGATTAAGGACTTGGGTGCAGG - Intergenic
1169772235 20:9214021-9214043 CTGATAAAGAACTTTTATCCAGG - Intronic
1171874437 20:30559577-30559599 CTGAGAAAGGATTCGTATCTAGG - Intergenic
1173363031 20:42361280-42361302 GTGGTGAAGGTCTTGTATCTGGG + Intronic
1175906797 20:62384304-62384326 CTGATAAAAGACCTGTATCCAGG - Intergenic
1176456035 21:6911909-6911931 CTTATTAAGGTCTTGTTGCTGGG - Intergenic
1176834208 21:13776957-13776979 CTTATTAAGGTCTTGTTGCTGGG - Intergenic
1181376546 22:22463220-22463242 CTAATTAAGTGCTTGTGTCTGGG + Intergenic
1181499686 22:23308899-23308921 TTGATTTAGGGCTTGTTTCTGGG + Intronic
1181642377 22:24209741-24209763 CAGACCCAGGACTTGTATCTTGG + Intergenic
1181797349 22:25319850-25319872 CTCATGAATGACTTCTATCTGGG + Intergenic
1181940775 22:26474687-26474709 CTGACAAAGAACTGGTATCTAGG + Intronic
1182138137 22:27925986-27926008 CTGAGAAAGGACTTATATGTAGG - Intergenic
1182207909 22:28647240-28647262 TGGATTAAGGACTTAAATCTAGG + Intronic
1182864485 22:33591541-33591563 CTGATGAAAGATTTGTATCTGGG - Intronic
1183729295 22:39608535-39608557 CTGGGTTAGGACTTGTATCCTGG + Intronic
949547616 3:5085249-5085271 GTGACTAAGGACTTACATCTAGG - Intergenic
951561602 3:23972513-23972535 AAGATTAAGGACTTGCATGTAGG + Intronic
955452248 3:59081752-59081774 CTGATAAGGGACTTGTATCAAGG - Intergenic
955861636 3:63336850-63336872 GTGATAAAGCACTTGTATCCAGG + Intronic
956286078 3:67612051-67612073 CTTATTAAGAATTTGTAGCTGGG + Intronic
959572077 3:107895474-107895496 CTTATTAAGGACTTACAGCTGGG + Intergenic
961019589 3:123493807-123493829 CTGACTATGGACTTATAGCTTGG + Exonic
961968302 3:130929503-130929525 CAGCTTAAAAACTTGTATCTGGG + Intronic
963077843 3:141364331-141364353 CTGATAAGGGACTTGTGTCTGGG + Intronic
967538651 3:190638497-190638519 CTGACAAAGGACTGGTATCCAGG - Intronic
967760635 3:193221670-193221692 CTGATAAGGGACTTCTATCCAGG - Intergenic
968293994 3:197559542-197559564 CTGAGCAAGGACTTGTGTATAGG - Intronic
969179543 4:5426775-5426797 CTGATAAAGGAATTCTATCCAGG - Intronic
974618535 4:64323718-64323740 CTGATCAAGAAGTTGAATCTAGG - Intronic
975065910 4:70063604-70063626 CTCATTAAGGAAATGTATATGGG - Intergenic
975421576 4:74170680-74170702 CTGATAAAGGACATGAATCTAGG + Intronic
976078611 4:81328539-81328561 TTGATAAGGGACTTGTATCCAGG + Intergenic
976468203 4:85395792-85395814 CTGCTTAAGGACTGGCATCCTGG + Intergenic
977933776 4:102778137-102778159 CTGACAAAGGATGTGTATCTAGG - Intergenic
979698961 4:123645831-123645853 CTAATTAAGGACATGTCTCTAGG + Intergenic
980695920 4:136355419-136355441 CTTATTAAGGTCTTGTTGCTGGG + Intergenic
981078187 4:140611893-140611915 TTGATGAAGGACTTGTCACTGGG - Intergenic
981910506 4:149975698-149975720 CTGACAAAGGGCTTGTATCCAGG + Intergenic
985107593 4:186514266-186514288 CAGATCCAGGACTTATATCTTGG + Intronic
985115602 4:186587084-186587106 CAGCTTAAGGAGTTGTAACTGGG + Intergenic
986852781 5:11832393-11832415 CTAATAAAAGACTTGTATCCAGG + Intronic
988506571 5:31828863-31828885 CTGCTAAGGAACTTGTATCTAGG - Intronic
990932004 5:61102741-61102763 CTGACAAAGGAATTGTATCTAGG + Intronic
991080282 5:62591156-62591178 CTGGTAATGGACTTGAATCTAGG - Intronic
996630230 5:125622806-125622828 CTGATAAAGGACTTGTACCCAGG - Intergenic
997497716 5:134344395-134344417 CTGATAAGGAATTTGTATCTAGG + Intronic
998847811 5:146327828-146327850 CTGATCGAGGAAATGTATCTAGG - Intronic
998931521 5:147186730-147186752 TTGACAAAGGACTAGTATCTAGG + Intergenic
999875432 5:155800417-155800439 CTGATTGGGGAATTATATCTTGG + Intergenic
1002706779 5:181166121-181166143 TTGACAAAGGACTTGTAGCTGGG + Intergenic
1004200026 6:13539623-13539645 CTGATAAGGGACTTGCATCTAGG + Intergenic
1004303577 6:14479929-14479951 CTGGTTAAGGACTTGTAGAAAGG + Intergenic
1004493153 6:16136923-16136945 CTGACAAAGGACTGGTATCTAGG - Intronic
1005590654 6:27322583-27322605 CTGACAATGAACTTGTATCTAGG - Intergenic
1005805316 6:29468723-29468745 CTGATGAAGGACTCATATGTAGG - Intergenic
1006747485 6:36354139-36354161 CTGATAAAAGAATTGTATCCAGG - Intergenic
1006892327 6:37439549-37439571 TTGATTAAGGTCATGAATCTGGG - Intronic
1008694130 6:54014318-54014340 CTGATAAAAGATTTGTATCCAGG - Intronic
1008863165 6:56176433-56176455 CTGATTAAGGAATTTTATTGAGG + Intronic
1010059628 6:71607539-71607561 GTGTTTAAGGACTTGTCTGTGGG + Intergenic
1010164689 6:72901483-72901505 TGGATTAAGGACTTAAATCTAGG - Intronic
1012351112 6:98251594-98251616 CTGGTTGAGAACTTGTATATAGG + Intergenic
1014207749 6:118674584-118674606 CTGATAAGGGATTTGTATCCAGG + Intronic
1014310482 6:119794310-119794332 CTGAGTAAGGACTGGAACCTTGG + Intergenic
1014572960 6:123033816-123033838 CTGACAAAAGACTTTTATCTAGG + Intronic
1014625309 6:123717735-123717757 CTGATAAAAGACTTGTAACCAGG - Intergenic
1016640948 6:146348758-146348780 CTGGTTTAGGACTTCTCTCTGGG - Intronic
1020783093 7:12539691-12539713 CTGATTAAAGACTTCTTCCTTGG - Intergenic
1022169608 7:27812378-27812400 CTGACAAAGGAATTATATCTGGG - Intronic
1023997105 7:45166548-45166570 CTGATAAAAGACTTGTACCCAGG - Intronic
1024475929 7:49811115-49811137 CTGATAAAAGACTTGTATCCAGG + Intronic
1026346358 7:69477616-69477638 CTGAGTCAGGACTTGAATCTGGG + Intergenic
1027363011 7:77428770-77428792 CCAGTTCAGGACTTGTATCTTGG - Intergenic
1028637819 7:93009950-93009972 CTGATGAAGGGCTTGTATCCAGG - Intergenic
1030019843 7:105262613-105262635 CTGATTATAGTCTTGTAACTGGG - Intronic
1031109104 7:117584060-117584082 CCGATAAAGGACTAGTATCCAGG - Intronic
1031789182 7:126078724-126078746 CTGATAAAGGATTTGTACCAAGG - Intergenic
1031880432 7:127192136-127192158 CTGATTAAGAAATTCTACCTGGG + Intronic
1033714723 7:143988282-143988304 CTGATTAAGCACTTCCCTCTAGG + Intergenic
1034329004 7:150266673-150266695 CTGACAAAGAATTTGTATCTAGG + Intronic
1034550340 7:151816424-151816446 CTGATCCAGGACTTGGACCTGGG - Intronic
1034736929 7:153438087-153438109 CTGATGAATGACTTGTTTATTGG - Intergenic
1038098711 8:24346858-24346880 CTGTTTAAGGATGTGTATTTAGG - Intronic
1038662601 8:29510190-29510212 CTGATTAAAGCCTTCTTTCTTGG + Intergenic
1039528591 8:38238582-38238604 CTGATTATGCACTGCTATCTAGG + Intronic
1040100574 8:43498659-43498681 CTGATAAGGGACTTATATCTAGG - Intergenic
1041580475 8:59453634-59453656 CTGATAAATGACTTGTATCCAGG - Intergenic
1041580478 8:59453811-59453833 CTGATAAATGACTTGTATCCTGG + Intergenic
1041657687 8:60370293-60370315 CAGAATAATGACTGGTATCTGGG - Intergenic
1041817728 8:61994195-61994217 CTGATGGGGGACTTGTATCTAGG - Intergenic
1041929396 8:63270402-63270424 CTGATTAAGGAATTTTGTTTTGG - Intergenic
1041943040 8:63409547-63409569 CTGATACAGGACTTGGCTCTGGG - Intergenic
1042335399 8:67624950-67624972 CTGATTAAAGCCTTCTTTCTTGG - Intronic
1042341138 8:67680991-67681013 TTGATAAAAGACTTGTATCCAGG - Intronic
1042775069 8:72421129-72421151 CTTATGAAGGATTTGTAGCTCGG - Intergenic
1042831324 8:73032083-73032105 CTTATTAAGGTCTTGTTGCTGGG - Exonic
1043985034 8:86684098-86684120 CTGACAAAGGTCTAGTATCTAGG + Intronic
1046277280 8:111980596-111980618 CTGATTAAAGCCTTCTTTCTTGG - Intergenic
1046775723 8:118161644-118161666 CTGGCAAAGGGCTTGTATCTAGG + Intergenic
1048814027 8:138314383-138314405 CTGACAAAGGACTATTATCTAGG + Intronic
1050342344 9:4653605-4653627 CTAACAAAGGTCTTGTATCTAGG + Intronic
1051158441 9:14177476-14177498 CTTATTAAGGAATTCTATTTTGG - Intronic
1051275783 9:15396697-15396719 CTTATGAAGGATTTGTATCTAGG - Intergenic
1051712155 9:19942416-19942438 CTGATTCAGGACTTATGTCCAGG + Intergenic
1052287473 9:26802916-26802938 CTGACAAAGGACTGGTACCTAGG + Intergenic
1053471550 9:38349552-38349574 CTGACAAAGGACTAATATCTGGG - Intergenic
1054880879 9:70143289-70143311 CTAATTAATGACTGGAATCTGGG + Intronic
1056367973 9:85924959-85924981 CTGATACAAGACTTGTATATAGG - Intergenic
1056394769 9:86171677-86171699 CTGATAAAGAACTTGTCTCTAGG - Intergenic
1057094197 9:92290430-92290452 CTGATAAAGGATTTGTATCCAGG - Intronic
1057959107 9:99437904-99437926 TTGATTAGGGACTTGTGTCCAGG - Intergenic
1058096078 9:100861942-100861964 CTGATTAAGGACATGTTCCCGGG + Intergenic
1058289152 9:103215445-103215467 CTGATTAAGGAATTATTTATGGG + Intergenic
1059081733 9:111257025-111257047 CTTATTGTGGACTAGTATCTGGG - Intergenic
1061100529 9:128488441-128488463 CAGAGTAAGGACTTGAATCCAGG - Intronic
1186767537 X:12786452-12786474 CTGATGAGGGTCTTGTATCTAGG - Intergenic
1189541439 X:41995172-41995194 CTGATAAAGGATTTGTTTCTAGG + Intergenic
1189612541 X:42752698-42752720 TTGATTAAGGACTTCTCTCAGGG - Intergenic
1190001654 X:46694353-46694375 TTGATAAAGAACTTGTATCTAGG + Intronic
1190813903 X:53911338-53911360 CTGACGAAGGACTCATATCTAGG - Intergenic
1192455933 X:71275686-71275708 CTGATAAGGGGCTTGTATCCAGG - Intergenic
1192708914 X:73558984-73559006 GTAATAAAGGACTTCTATCTAGG + Intergenic
1192884955 X:75327081-75327103 CTTATTAAGGTCTTGTTGCTGGG + Intergenic
1193265227 X:79460948-79460970 CTGATTAAAGACAAGCATCTGGG + Intergenic
1193620615 X:83749128-83749150 CTTATTAAGGTCTTGTTGCTCGG + Intergenic
1193777957 X:85667011-85667033 CTGATAAAGGATTTGCATCCAGG - Intergenic
1194008484 X:88528894-88528916 CTGATTAAAGTCTTCTTTCTTGG - Intergenic
1195420548 X:104670497-104670519 CTGGTAAAGTACTTGTTTCTGGG - Intronic
1195514475 X:105757607-105757629 CTGAGTAGGGGCTTGGATCTTGG + Intronic
1196184315 X:112729427-112729449 CAAAGTAAGGACTAGTATCTAGG + Intergenic
1196292537 X:113960269-113960291 CTTATTAAGGACCTTTGTCTTGG + Intergenic
1197240692 X:124119789-124119811 CTGAAAAAGGACTGGTATCCAGG + Intronic
1197390468 X:125857359-125857381 CTGAACAAGGACTTATATTTTGG - Intergenic
1197520781 X:127493645-127493667 CTGAGAAAAGATTTGTATCTAGG + Intergenic
1197664184 X:129205591-129205613 CTGACAAAGGACTAATATCTAGG - Intergenic
1198417925 X:136439632-136439654 CTCATTAAGGACTTGTACCTTGG + Intergenic
1199667241 X:150107274-150107296 CTGACAAAGGACTGGTATCTAGG - Intergenic
1200132502 X:153858636-153858658 CTCAATAAGGACTTGTTTCACGG + Intergenic
1200297636 X:154938704-154938726 CCAACCAAGGACTTGTATCTAGG + Intronic
1201784008 Y:17753434-17753456 TTTATGAAGGACTTGTATGTGGG - Intergenic
1201817545 Y:18152553-18152575 TTTATGAAGGACTTGTATGTGGG + Intergenic