ID: 1155458016

View in Genome Browser
Species Human (GRCh38)
Location 18:26041882-26041904
Sequence GTAATTGAGCTCTTTGGGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155458016_1155458021 13 Left 1155458016 18:26041882-26041904 CCAATCCCAAAGAGCTCAATTAC No data
Right 1155458021 18:26041918-26041940 CTGTCACTTCTCTCCCTCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155458016 Original CRISPR GTAATTGAGCTCTTTGGGAT TGG (reversed) Intronic